Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2244
Trapped Gene
Nedd4 (ENSMUSG00000032216)
Vector Insertion
Chr 9: 72574338 - 72578708
Public Clones AL0362 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217764 (Chr9:72574218..72574337 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAACCACCACATGGTCCAA Chr9:72574305..72574324 61.06 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217764 (Chr9:72574218..72574337 +)
Downstram Exon
ENSMUSE00000217794 (Chr9:72578709..72578780 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAACCACCACATGGTCCAA Chr9:72574305..72574324 61.06 45 CAGGGATTTTCGATCTTGGA Chr9:72578736..72578755 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000635601 Chr9:72510364..72510420 CCAGTACTCTCGGAGGACGA Chr9:72510400..72510419 60.4 60
upstream ENSMUSE00000311269 Chr9:72517759..72517923 TCACTGCTGATCCGTACCTG Chr9:72517892..72517911 59.85 55
upstream ENSMUSE00000406942 Chr9:72519037..72519110 ATAGGCCTGGCCAAGAAAGA Chr9:72519076..72519095 61.08 50
upstream ENSMUSE00000356446 Chr9:72525122..72525200 CTTACCAGCGTGCAGACAAA Chr9:72525168..72525187 60.05 50
upstream ENSMUSE00000311211 Chr9:72525300..72525338 No primer for this exon
upstream ENSMUSE00000311189 Chr9:72533868..72533921 CCGCATTCTTTTCGAAGTGT Chr9:72533885..72533904 60.25 45
upstream ENSMUSE00000217798 Chr9:72556919..72556969 AGGTCAAGTGGATGTCCCTCT Chr9:72556936..72556956 59.98 52.38
upstream ENSMUSE00000531958 Chr9:72558285..72558346 CCCAAGAATGGAGAGACCAT Chr9:72558293..72558312 58.94 50
upstream ENSMUSE00000217796 Chr9:72559974..72560073 CAGACCAGGCTGAGGAGTTAG Chr9:72560051..72560071 59.1 57.14
upstream ENSMUSE00000217781 Chr9:72566025..72566191 GGTTGTTTTGGACCAACCAG Chr9:72566033..72566052 60.25 50
upstream ENSMUSE00000217766 Chr9:72569108..72569225 ATATCGGAGGATGTGGATGG Chr9:72569181..72569200 59.59 50
upstream ENSMUSE00000217811 Chr9:72569304..72569468 GTGCAGACTCACCTTGCAGA Chr9:72569385..72569404 60.19 55
upstream ENSMUSE00000217808 Chr9:72572824..72572889 GGCAGCTTGCAGACCTGTAT Chr9:72572842..72572861 60.43 55
upstream ENSMUSE00000217764 Chr9:72574218..72574337 AAAACCACCACATGGTCCAA Chr9:72574305..72574324 61.06 45

*** Putative Vector Insertion (Chr 9: 72574338 - 72578708) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000217794 Chr9:72578709..72578780 CAGGGATTTTCGATCTTGGA Chr9:72578736..72578755 60.01 45
downstream ENSMUSE00000217762 Chr9:72579029..72579083 GAAGAAGACTCGCCCATCTG Chr9:72579076..72579095 59.95 55
downstream ENSMUSE00000217773 Chr9:72579185..72579243 AGGATCTTCCCACTGGGTCT Chr9:72579216..72579235 59.93 55
downstream ENSMUSE00000217792 Chr9:72580399..72580464 No primer for this exon
downstream ENSMUSE00000217760 Chr9:72582817..72583046 CAGGCCGTAGTAAGGGTTGA Chr9:72583032..72583051 60.12 55
downstream ENSMUSE00000217790 Chr9:72584474..72584595 GCCATGATAAACTGCCATCC Chr9:72584585..72584604 60.3 50
downstream ENSMUSE00000493621 Chr9:72584681..72584751 GACTCCATGTCGTGCAGTGT Chr9:72584750..72584769 59.74 55
downstream ENSMUSE00000309688 Chr9:72586847..72586942 TCAAGAATCCATCGCAGAGA Chr9:72586887..72586906 59.48 45
downstream ENSMUSE00000217775 Chr9:72587262..72587335 CTCTGATCCTCCGGTTTTCA Chr9:72587300..72587319 60.19 50
downstream ENSMUSE00000217759 Chr9:72587975..72588035 TGGATACGGTTCACAAATCG Chr9:72588013..72588032 59.4 45
downstream ENSMUSE00000531935 Chr9:72589435..72589494 No primer for this exon
downstream ENSMUSE00000309593 Chr9:72590460..72590567 CCAGAACCAGTGGATGACCT Chr9:72590567..72590586 59.96 55
downstream ENSMUSE00000217809 Chr9:72591347..72591443 TTTTTCCGAATCCATCATCC Chr9:72591376..72591395 59.7 40
downstream ENSMUSE00000217813 Chr9:72594214..72594286 GCTCTTGGCAGCTTATCAGG Chr9:72594280..72594299 60.12 55
downstream ENSMUSE00000583984 Chr9:72594933..72597649 TCACATCCTGCCGTACACAT Chr9:72595269..72595288 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCATGGAGGCCAGAAGAG Chr9:72577301..72577321 62.13 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCATGGAGGCCAGAAGAG Chr9:72577301..72577321 62.13 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032216