Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22468
Trapped Gene
Mypn (ENSMUSG00000020067)
Vector Insertion
Chr 10: 62626373 - 62629980
Public Clones CMHD-GT_437G8-3 (cmhd)
Private Clones OST296252 (lexicon) OST187116 (lexicon) OST170690 (lexicon) OST83588 (lexicon)
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000100285 (Chr10:62629981..62630032 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000100285 (Chr10:62629981..62630032 -)
Downstram Exon
ENSMUSE00000100290 (Chr10:62626261..62626372 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000612419 Chr10:62666466..62666700 No primer for this exon
upstream ENSMUSE00000612418 Chr10:62655135..62656031 No primer for this exon
upstream ENSMUSE00000420052 Chr10:62632003..62632178 No primer for this exon
upstream ENSMUSE00000100285 Chr10:62629981..62630032 No primer for this exon

*** Putative Vector Insertion (Chr 10: 62626373 - 62629980) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000100290 Chr10:62626261..62626372 No primer for this exon
downstream ENSMUSE00000100288 Chr10:62624970..62625041 No primer for this exon
downstream ENSMUSE00000612399 Chr10:62615543..62615684 No primer for this exon
downstream ENSMUSE00000642939 Chr10:62612771..62612794 No primer for this exon
downstream ENSMUSE00000612398 Chr10:62610625..62610741 No primer for this exon
downstream ENSMUSE00000100295 Chr10:62608584..62608956 No primer for this exon
downstream ENSMUSE00000612417 Chr10:62598456..62599043 No primer for this exon
downstream ENSMUSE00000612397 Chr10:62597681..62597819 No primer for this exon
downstream ENSMUSE00000612396 Chr10:62593731..62593952 No primer for this exon
downstream ENSMUSE00000612402 Chr10:62590376..62590525 No primer for this exon
downstream ENSMUSE00000100278 Chr10:62588417..62588496 No primer for this exon
downstream ENSMUSE00000100286 Chr10:62586019..62586145 No primer for this exon
downstream ENSMUSE00000100292 Chr10:62584650..62584857 No primer for this exon
downstream ENSMUSE00000100281 Chr10:62582777..62582942 No primer for this exon
downstream ENSMUSE00000100296 Chr10:62581169..62581302 No primer for this exon
downstream ENSMUSE00000411135 Chr10:62578543..62579774 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr10:62629910..62629930 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCTCAGACCCCAAGAGAA Chr10:62629935..62629955 59.23 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020067