Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2248
Trapped Gene
Acvr2a (ENSMUSG00000052155)
Vector Insertion
Chr 2: 48728994 - 48745817
Public Clones AL0479 (sanger) AR0561 (sanger) AL0106 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000162458 (Chr2:48728839..48728993 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTACACCGAAGCCACCCTA Chr2:48728853..48728872 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000162458 (Chr2:48728839..48728993 +)
Downstram Exon
ENSMUSE00000162460 (Chr2:48745818..48745961 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTACACCGAAGCCACCCTA Chr2:48728853..48728872 59.99 55 ACCAAATCTTCCCCTTGCTT Chr2:48745904..48745923 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000485662 Chr2:48669677..48670346 GGGGCTTCCGAATATGTTTT Chr2:48670171..48670190 60.15 45
upstream ENSMUSE00000389709 Chr2:48725809..48726016 TAAACGGCGACATTGTTTTG Chr2:48725918..48725937 59.6 40
upstream ENSMUSE00000162461 Chr2:48728577..48728686 TTTTCCGGAGATGGAAGTCA Chr2:48728661..48728680 60.57 45
upstream ENSMUSE00000162458 Chr2:48728839..48728993 GTTACACCGAAGCCACCCTA Chr2:48728853..48728872 59.99 55

*** Putative Vector Insertion (Chr 2: 48728994 - 48745817) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000162460 Chr2:48745818..48745961 ACCAAATCTTCCCCTTGCTT Chr2:48745904..48745923 59.94 45
downstream ENSMUSE00000162454 Chr2:48747649..48747792 TGTGATTAGCCACAGGTCCA Chr2:48747780..48747799 60.11 50
downstream ENSMUSE00000274661 Chr2:48749027..48749172 CCTCTAGCCATGGTTTCTGC Chr2:48749109..48749128 59.84 55
downstream ENSMUSE00000162456 Chr2:48750186..48750300 TAAGGCCAACCCAAAGTCAG Chr2:48750261..48750280 60.1 50
downstream ENSMUSE00000567247 Chr2:48752492..48752630 AGGACTAATCCCATGGCGTA Chr2:48752598..48752617 59.41 50
downstream ENSMUSE00000162457 Chr2:48753998..48754128 TGCACAACAACTTCCTGCAT Chr2:48754085..48754104 60.31 45
downstream ENSMUSE00000377416 Chr2:48755114..48757683 AAGAGTTTGAGGGGCCAAAT Chr2:48757215..48757234 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTCATGTTTAATCGCCTTGC Chr2:48741036..48741057 59.09 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCCACCTTCCAACAGTTA Chr2:48740951..48740971 61.46 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052155