Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22481
Trapped Gene
Glrx2 (ENSMUSG00000018196)
Vector Insertion
Chr 1: 145588842 - 145592176
Public Clones not available
Private Clones OST295866 (lexicon) OST289824 (lexicon) OST241596 (lexicon) OST145562 (lexicon)
OST127202 (lexicon)
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000659145 (Chr1:145588778..145588841 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000659145 (Chr1:145588778..145588841 +)
Downstram Exon
ENSMUSE00000158408 (Chr1:145592177..145592353 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000659143 Chr1:145586747..145586814 No primer for this exon
upstream ENSMUSE00000538376 Chr1:145586791..145586888 No primer for this exon
upstream ENSMUSE00000342690 Chr1:145588778..145588841 No primer for this exon
upstream ENSMUSE00000659145 Chr1:145588778..145588841 No primer for this exon

*** Putative Vector Insertion (Chr 1: 145588842 - 145592176) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000158408 Chr1:145592177..145592353 No primer for this exon
downstream ENSMUSE00000595561 Chr1:145593638..145593904 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACCAATAATCGCCTTGCAG Chr1:145591887..145591907 60.1 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCAACGTGACTGGGAAAAC Chr1:145591888..145591908 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018196