Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2250
Trapped Gene
Ikzf5 (ENSMUSG00000040167)
Vector Insertion
Chr 7: 138553900 - 138553993
Public Clones AL0096 (sanger) XB583 (baygenomics) RRU421 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000487303 (Chr7:138553901..138553992 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000487303 (Chr7:138553901..138553992 -)
Downstram Exon
ENSMUSE00000715619 (Chr7:138553901..138554011 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGTAGCCGCCATATTTGTTG Chr7:138553969..138553988 59.58 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000487303 Chr7:138553901..138553992 No primer for this exon
upstream ENSMUSE00000715619 Chr7:138553901..138554011 CAACAAATATGGCGGCTACA Chr7:138553991..138554010 59.58 45

*** Putative Vector Insertion (Chr 7: 138553900 - 138553993) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000489259 Chr7:138540183..138540365 GTTCACATGATGCGTCTGCT Chr7:138540213..138540232 59.87 50
downstream ENSMUSE00000719077 Chr7:138540183..138540365 GTTCACATGATGCGTCTGCT Chr7:138540213..138540232 59.87 50
downstream ENSMUSE00000343074 Chr7:138537269..138537451 TGCAGTACCGACACTTGAGC Chr7:138537301..138537320 60.06 55
downstream ENSMUSE00000714442 Chr7:138533882..138535635 ATGATGCGCTCACTTCCTCT Chr7:138534258..138534277 59.98 50
downstream ENSMUSE00000397988 Chr7:138532164..138536094 CAAGACTTGCACCTCGCATA Chr7:138532280..138532299 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGCGGAGACACAACAAAT Chr7:138554001..138554021 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGCGGAGACACAACAAAT Chr7:138554001..138554021 60.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040167