Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22500
Trapped Gene
Nsf (ENSMUSG00000034187)
Vector Insertion
Chr 11: 103775223 - 103777819
Public Clones not available
Private Clones OST295222 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000227072 (Chr11:103777820..103777986 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCCTTACGACACCGACAAG Chr11:103777877..103777896 60.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000227072 (Chr11:103777820..103777986 -)
Downstram Exon
ENSMUSE00000227066 (Chr11:103775115..103775222 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCCTTACGACACCGACAAG Chr11:103777877..103777896 60.03 55 GATCCATGGCTTCAATGTCC Chr11:103775137..103775156 60.29 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661191 Chr11:103815284..103815323 No primer for this exon
upstream ENSMUSE00000671822 Chr11:103815284..103815338 No primer for this exon
upstream ENSMUSE00000671821 Chr11:103792390..103792437 No primer for this exon
upstream ENSMUSE00000671823 Chr11:103792385..103792396 No primer for this exon
upstream ENSMUSE00000227092 Chr11:103792044..103792129 TAAGCAACTGTGCGGTTGTG Chr11:103792070..103792089 60.9 50
upstream ENSMUSE00000227084 Chr11:103790058..103790157 ACGTCCCCCAATCACAAGTA Chr11:103790122..103790141 60.23 50
upstream ENSMUSE00000227079 Chr11:103787462..103787501 GGGCTGGACTTTCTATTGGAC Chr11:103787474..103787494 59.95 52.38
upstream ENSMUSE00000227072 Chr11:103777820..103777986 ACCCTTACGACACCGACAAG Chr11:103777877..103777896 60.03 55

*** Putative Vector Insertion (Chr 11: 103775223 - 103777819) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000227066 Chr11:103775115..103775222 GATCCATGGCTTCAATGTCC Chr11:103775137..103775156 60.29 50
downstream ENSMUSE00000227060 Chr11:103774630..103774705 GAGCGACGAATTTTCTGCTT Chr11:103774618..103774637 59.6 45
downstream ENSMUSE00000227055 Chr11:103771757..103771912 GATGATGGACTGGCGATTTT Chr11:103771853..103771872 59.9 45
downstream ENSMUSE00000671819 Chr11:103770740..103771912 GCATGGACGACGACAATATG Chr11:103771420..103771439 59.96 50
downstream ENSMUSE00000227052 Chr11:103744056..103744255 GGGGGTCCGTATAACAGGAT Chr11:103744194..103744213 59.9 55
downstream ENSMUSE00000227049 Chr11:103734459..103734624 CAAGCCACTGTTAGCACCAA Chr11:103734582..103734601 59.9 50
downstream ENSMUSE00000227046 Chr11:103733905..103733979 GTCGAAGGAGAGCTTCGTCT Chr11:103733913..103733932 58.77 55
downstream ENSMUSE00000227040 Chr11:103733473..103733660 TGGAGTCGACCCTTCTCATC Chr11:103733611..103733630 60.2 55
downstream ENSMUSE00000227033 Chr11:103724553..103724648 TATCGTTCTCCAGGGAAGCA Chr11:103724539..103724558 60.73 50
downstream ENSMUSE00000227024 Chr11:103723207..103723363 CCGGTCACTGTTTTTCGTTT Chr11:103723213..103723232 60.01 45
downstream ENSMUSE00000227017 Chr11:103720209..103720342 CTGTCTCGGAGAAGCCAATC Chr11:103720210..103720229 59.95 55
downstream ENSMUSE00000227011 Chr11:103709308..103709374 TCAATGTCATCCACGACCAC Chr11:103709297..103709316 60.39 50
downstream ENSMUSE00000227000 Chr11:103707688..103707767 AGGCGCCTTTTTCAGTAACA Chr11:103707672..103707691 59.88 45
downstream ENSMUSE00000226987 Chr11:103689746..103689880 TGGTCCCGATGATAAGAAGC Chr11:103689831..103689850 60.04 50
downstream ENSMUSE00000226980 Chr11:103688525..103688638 CAATTGTGGTGCGTTCCTTA Chr11:103688577..103688596 59.58 45
downstream ENSMUSE00000661190 Chr11:103685053..103685108 GGCCAAGAATTTCCTCACAC Chr11:103685051..103685070 59.53 50
downstream ENSMUSE00000671824 Chr11:103683099..103684573 GAGAGAGGCGGACACTTCAC Chr11:103684419..103684438 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCAGCAGTTCAACAACCAG Chr11:103777839..103777859 59.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCAGCAGTTCAACAACCAG Chr11:103777839..103777859 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034187