Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22522
Trapped Gene
Rdbp (ENSMUSG00000024369)
Vector Insertion
Chr 17: 34987534 - 34987855
Public Clones not available
Private Clones OST293550 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000657486 (Chr17:34987355..34987533 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGAGGGCTTCGTCTCACAT Chr17:34987408..34987427 60.27 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000657486 (Chr17:34987355..34987533 +)
Downstram Exon
ENSMUSE00000488171 (Chr17:34987856..34987938 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGAGGGCTTCGTCTCACAT Chr17:34987408..34987427 60.27 55 TCTGCAGTGCCTCTTCCTCT Chr17:34987915..34987934 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657486 Chr17:34987355..34987533 GTGAGGGCTTCGTCTCACAT Chr17:34987408..34987427 60.27 55

*** Putative Vector Insertion (Chr 17: 34987534 - 34987855) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000488171 Chr17:34987856..34987938 TCTGCAGTGCCTCTTCCTCT Chr17:34987915..34987934 60.28 55
downstream ENSMUSE00000141417 Chr17:34989289..34989358 AGAGCCAGCAATGCCTTTTT Chr17:34989311..34989330 61.25 45
downstream ENSMUSE00000141418 Chr17:34989461..34989606 ACCAGTTGTTTGGCCTGTTC Chr17:34989524..34989543 60.01 50
downstream ENSMUSE00000141421 Chr17:34990370..34990444 AGACATGCTCCTCTGGAACG Chr17:34990426..34990445 60.41 55
downstream ENSMUSE00000141409 Chr17:34990558..34990595 No primer for this exon
downstream ENSMUSE00000141419 Chr17:34990753..34991078 CCGAAGCCGATCACTAGAAG Chr17:34990783..34990802 59.97 55
downstream ENSMUSE00000141413 Chr17:34991166..34991310 TCCATGGAGAGGTCGATGAT Chr17:34991301..34991320 60.44 50
downstream ENSMUSE00000141420 Chr17:34991390..34991444 CTGCAGACTCCATCTTCTCG Chr17:34991430..34991449 58.7 55
downstream ENSMUSE00000141407 Chr17:34991641..34991743 GCTGTTTTCGGGCTATGTTG Chr17:34991701..34991720 60.64 50
downstream ENSMUSE00000474333 Chr17:34993033..34993314 GTCTCGATGGCAACCCTTAG Chr17:34993070..34993089 59.69 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGCCATCGCCTTGTAATC Chr17:34987570..34987590 61.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTGCGTGACTGGGAAAACC Chr17:34987581..34987601 62.9 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024369