Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22535
Trapped Gene
Arrdc1 (ENSMUSG00000026972)
Vector Insertion
Chr 2: 24783360 - 24790547
Public Clones (ggtc) (ggtc)
Private Clones OST292943 (lexicon)
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000164964 (Chr2:24790548..24790685 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCGAGATCCGCCTGAGTC Chr2:24790629..24790648 62.4 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000164964 (Chr2:24790548..24790685 -)
Downstram Exon
ENSMUSE00000660808 (Chr2:24783249..24783359 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCGAGATCCGCCTGAGTC Chr2:24790629..24790648 62.4 60 CAGTGACAGGGAGCTGTTGA Chr2:24783237..24783256 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000164964 Chr2:24790548..24790685 CTTCGAGATCCGCCTGAGTC Chr2:24790629..24790648 62.4 60

*** Putative Vector Insertion (Chr 2: 24783360 - 24790547) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000660808 Chr2:24783249..24783359 CAGTGACAGGGAGCTGTTGA Chr2:24783237..24783256 60.02 55
downstream ENSMUSE00000660807 Chr2:24782646..24782696 AAGGGAAGTTGTGCTCTCCA Chr2:24782642..24782661 59.84 50
downstream ENSMUSE00000699233 Chr2:24782434..24782546 GATCCTTGGAAAAACGTGGA Chr2:24782441..24782460 59.91 45
downstream ENSMUSE00000164975 Chr2:24782398..24782552 GATCCTTGGAAAAACGTGGA Chr2:24782441..24782460 59.91 45
downstream ENSMUSE00000164970 Chr2:24782065..24782247 ACCACATAGCCACGAAGGTC Chr2:24782125..24782144 60 55
downstream ENSMUSE00000660806 Chr2:24781792..24781965 GGTCCGCACATCATAGATCC Chr2:24781902..24781921 60.31 55
downstream ENSMUSE00000713251 Chr2:24781792..24781968 GGTCCGCACATCATAGATCC Chr2:24781902..24781921 60.31 55
downstream ENSMUSE00000721400 Chr2:24781792..24781968 GGTCCGCACATCATAGATCC Chr2:24781902..24781921 60.31 55
downstream ENSMUSE00000164966 Chr2:24781276..24781714 GAGTGGCTCTTGGTGGAGAG Chr2:24781475..24781494 59.99 60
downstream ENSMUSE00000699234 Chr2:24781276..24781714 GAGTGGCTCTTGGTGGAGAG Chr2:24781475..24781494 59.99 60
downstream ENSMUSE00000394229 Chr2:24780875..24781196 GCACCACAGCTCTGCTCATA Chr2:24781141..24781160 60.17 55
downstream ENSMUSE00000660805 Chr2:24780875..24781196 GCACCACAGCTCTGCTCATA Chr2:24781141..24781160 60.17 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTTCTTACCTGCGTAATCG Chr2:24787490..24787510 58.46 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCCGGGAAGTGGGTAGAC Chr2:24790511..24790531 63.07 65 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGGGTGCAGCTCTTCGAGAT Chr2:24790638..24790658 61.47 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGGGTGCAGCTCTTCGAGAT Chr2:24790638..24790658 61.47 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026972