Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22553
Trapped Gene
Rbm26 (ENSMUSG00000022119)
Vector Insertion
Chr 14: 105559831 - 105575998
Public Clones (sanger) (sanger) D097E10 (ggtc) D097E10 (ggtc) IST14629B5 (tigm)
IST14183C5 (tigm)
Private Clones OST291994 (lexicon) OST142040 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000612247 (Chr14:105575999..105576544 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGCACCTAATCCCAAAGC Chr14:105576390..105576409 59.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000612247 (Chr14:105575999..105576544 -)
Downstram Exon
ENSMUSE00000503628 (Chr14:105559712..105559830 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGCACCTAATCCCAAAGC Chr14:105576390..105576409 59.71 50 TTGCTAGGGCTGATGGATCT Chr14:105559780..105559799 59.8 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000612247 Chr14:105575999..105576544 CAAGCACCTAATCCCAAAGC Chr14:105576390..105576409 59.71 50

*** Putative Vector Insertion (Chr 14: 105559831 - 105575998) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000503628 Chr14:105559712..105559830 TTGCTAGGGCTGATGGATCT Chr14:105559780..105559799 59.8 50
downstream ENSMUSE00000502732 Chr14:105559055..105559191 CTTCAGGCTTCCTGACGATG Chr14:105559078..105559097 60.93 55
downstream ENSMUSE00000493869 Chr14:105554079..105554167 TCTCGCTCTTCCTCCTTTGT Chr14:105554123..105554142 59.16 50
downstream ENSMUSE00000502164 Chr14:105552632..105552849 CGAGGAGGGTTTCGATCATA Chr14:105552762..105552781 60.03 50
downstream ENSMUSE00000501023 Chr14:105551509..105551769 CAATGACGGTAATGGTGCTG Chr14:105551607..105551626 59.99 50
downstream ENSMUSE00000500122 Chr14:105550536..105550775 TGTAAGGATCGGAGGAGGTG Chr14:105550587..105550606 60.06 55
downstream ENSMUSE00000505655 Chr14:105549966..105550106 TGGTGATGAATGCCAGTTGT Chr14:105549979..105549998 59.97 45
downstream ENSMUSE00000470369 Chr14:105549470..105549610 TTGGGGCTTCAGGATTGTAG Chr14:105549550..105549569 60.07 50
downstream ENSMUSE00000497565 Chr14:105549470..105549625 TTGGGGCTTCAGGATTGTAG Chr14:105549550..105549569 60.07 50
downstream ENSMUSE00000496450 Chr14:105543396..105543507 TTCCCCAGACCCAATAGTTC Chr14:105543409..105543428 58.84 50
downstream ENSMUSE00000495532 Chr14:105541908..105542067 CCTGGGCTGTTTGTCCTATT Chr14:105542016..105542035 59.05 50
downstream ENSMUSE00000517485 Chr14:105540413..105540577 TAAGGGCACCTTCAGGATCA Chr14:105540522..105540541 60.59 50
downstream ENSMUSE00000492951 Chr14:105539533..105539664 AAAATGGGCTGCTGGACTAA Chr14:105539611..105539630 59.71 45
downstream ENSMUSE00000432938 Chr14:105538308..105538379 ACCCAACCTGTCCTTCACAG Chr14:105538322..105538341 60 55
downstream ENSMUSE00000519162 Chr14:105531099..105531224 ACACCGTTTTTGTGAGACCA Chr14:105531166..105531185 59.03 45
downstream ENSMUSE00000509190 Chr14:105530700..105530774 TCCTGCTGAAGTTTCAGTGC Chr14:105530730..105530749 59.17 50
downstream ENSMUSE00000514490 Chr14:105529450..105529617 GAAGACAGCGTCCAGGAGAT Chr14:105529454..105529473 59.41 55
downstream ENSMUSE00000685176 Chr14:105527782..105527886 CTTCTTCTCCAGCCTGCATC Chr14:105527801..105527820 60.1 55
downstream ENSMUSE00000487174 Chr14:105523800..105524000 GGGTCGGTGATCCACTACAG Chr14:105523841..105523860 60.39 60
downstream ENSMUSE00000501222 Chr14:105520199..105520285 TGCTTCTGCTTCTGCTCTTG Chr14:105520177..105520196 59.62 50
downstream ENSMUSE00000646967 Chr14:105516203..105516316 CTTCAAATCCTGCCCTTTGA Chr14:105516253..105516272 60.18 45
downstream ENSMUSE00000646966 Chr14:105513736..105514503 TTGTGAAATCCATCGTCATCA Chr14:105514268..105514288 59.92 38.1
downstream ENSMUSE00000685169 Chr14:105508999..105509019 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr14:105572928..105572948 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCACAGAGGGCTTTTACA Chr14:105572968..105572988 59.88 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCTGGGGCCATCTTATTTCTA Chr14:105564571..105564592 60.41 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCTGGGGCCATCTTATTTCTA Chr14:105564571..105564592 60.41 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022119