Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22567
Trapped Gene
Bak1 (ENSMUSG00000057789)
Vector Insertion
Chr 17: 27157981 - 27158111
Public Clones not available
Private Clones OST291523 (lexicon) OST36075 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000409676 (Chr17:27158112..27158292 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGGCCCTGTACGTCTACC Chr17:27158213..27158232 60.13 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000409676 (Chr17:27158112..27158292 -)
Downstram Exon
ENSMUSE00000657949 (Chr17:27156759..27157980 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGGCCCTGTACGTCTACC Chr17:27158213..27158232 60.13 60 ACCATGCAATGTTGGGGTAT Chr17:27157663..27157682 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657950 Chr17:27165356..27165523 CAGCACCATGAATCCACTGA Chr17:27165473..27165492 60.69 50
upstream ENSMUSE00000657952 Chr17:27165356..27165571 TGGGACCTCCTCTATGGTCA Chr17:27165540..27165559 60.47 55
upstream ENSMUSE00000348899 Chr17:27162738..27162838 GGTCTCCACCAAGACCTGAA Chr17:27162804..27162823 60.09 55
upstream ENSMUSE00000249303 Chr17:27159687..27159822 TTACCTCCACCAGCAGGAAC Chr17:27159754..27159773 60.11 55
upstream ENSMUSE00000139555 Chr17:27159384..27159527 CGCTACGACACAGAGTTCCA Chr17:27159453..27159472 60.05 55
upstream ENSMUSE00000488015 Chr17:27158608..27158627 No primer for this exon
upstream ENSMUSE00000409676 Chr17:27158112..27158292 TCTGGCCCTGTACGTCTACC Chr17:27158213..27158232 60.13 60
upstream ENSMUSE00000487133 Chr17:27158112..27158292 TCTGGCCCTGTACGTCTACC Chr17:27158213..27158232 60.13 60

*** Putative Vector Insertion (Chr 17: 27157981 - 27158111) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000657949 Chr17:27156759..27157980 ACCATGCAATGTTGGGGTAT Chr17:27157663..27157682 59.94 45
downstream ENSMUSE00000657951 Chr17:27156759..27157980 ACCATGCAATGTTGGGGTAT Chr17:27157663..27157682 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGATGGATCGCACAGAGAG Chr17:27158118..27158138 59.53 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGATGGATCGCACAGAGAG Chr17:27158118..27158138 59.53 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057789