Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22589
Trapped Gene
Ccdc130 (ENSMUSG00000004994)
Vector Insertion
Chr 8: 86790974 - 86794240
Public Clones (sanger) 3SD142A07 (ggtc) IST10195E5 (tigm)
Private Clones OST290907 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000681573 (Chr8:86794241..86794259 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000681573 (Chr8:86794241..86794259 -)
Downstram Exon
ENSMUSE00000681572 (Chr8:86790735..86790973 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681573 Chr8:86794241..86794259 No primer for this exon

*** Putative Vector Insertion (Chr 8: 86790974 - 86794240) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000681572 Chr8:86790735..86790973 No primer for this exon
downstream ENSMUSE00000266244 Chr8:86788208..86788261 No primer for this exon
downstream ENSMUSE00000212092 Chr8:86787761..86787843 No primer for this exon
downstream ENSMUSE00000212091 Chr8:86786892..86786947 No primer for this exon
downstream ENSMUSE00000212087 Chr8:86785639..86785699 No primer for this exon
downstream ENSMUSE00000332670 Chr8:86784442..86784584 No primer for this exon
downstream ENSMUSE00000212085 Chr8:86784193..86784365 No primer for this exon
downstream ENSMUSE00000212089 Chr8:86783012..86783150 No primer for this exon
downstream ENSMUSE00000392263 Chr8:86781694..86782825 No primer for this exon
downstream ENSMUSE00000635630 Chr8:86781694..86782825 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCTAATCGCCTTGCAGCAC Chr8:86794172..86794192 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTAGGTACGGGGTGAGGAC Chr8:86794220..86794240 60.63 65 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GACTAATCGCCTTGCAGCAC Chr8:86794192..86794212 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGGTAGGTACGGGGTGAGGA Chr8:86794221..86794241 60.76 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004994