Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22590
Trapped Gene
Mizf (ENSMUSG00000032119)
Vector Insertion
Chr 9: 44110671 - 44113698
Public Clones (sanger) IST12054F1 (tigm)
Private Clones OST290858 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000637489 (Chr9:44113699..44113717 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000637489 (Chr9:44113699..44113717 -)
Downstram Exon
ENSMUSE00000372344 (Chr9:44110493..44110670 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGGTCGAAGAACTCCTCCAT Chr9:44110536..44110555 59.65 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637489 Chr9:44113699..44113717 No primer for this exon

*** Putative Vector Insertion (Chr 9: 44110671 - 44113698) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000372344 Chr9:44110493..44110670 TGGTCGAAGAACTCCTCCAT Chr9:44110536..44110555 59.65 50
downstream ENSMUSE00000263874 Chr9:44107646..44107875 GTAGACATGGCGGATGAGGT Chr9:44107774..44107793 59.96 55
downstream ENSMUSE00000263859 Chr9:44107296..44107407 GCCGATAGAACCACTCAGGA Chr9:44107352..44107371 60.22 55
downstream ENSMUSE00000263845 Chr9:44106956..44107108 GAAGCTTACACCGGTCCTTG Chr9:44107051..44107070 59.73 55
downstream ENSMUSE00000263818 Chr9:44106417..44106494 GCCTCTCTGTGGCAAATCTC Chr9:44106422..44106441 59.96 55
downstream ENSMUSE00000216701 Chr9:44106207..44106327 GTGATTCCGGAGGGAAGAAG Chr9:44106241..44106260 60.96 55
downstream ENSMUSE00000263776 Chr9:44105982..44106120 TCCGGAGGTCAATCAAATTC Chr9:44106073..44106092 59.87 45
downstream ENSMUSE00000263755 Chr9:44105776..44105900 CCACGTGTGAAGCATTTGTC Chr9:44105823..44105842 60.16 50
downstream ENSMUSE00000342535 Chr9:44102723..44104663 CTAAGCAGGCGAGAGCACTT Chr9:44103118..44103137 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr9:44113650..44113670 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTCTCGTGACTGGGAAAA Chr9:44113633..44113653 58 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GGGGTAGATGGTGTGAGGTG Chr9:44113731..44113751 60.24 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGGGTAGATGGTGTGAGGTG Chr9:44113731..44113751 60.24 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032119