Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22598
Trapped Gene
Lctl (ENSMUSG00000032401)
Vector Insertion
Chr 9: 63985612 - 63985913
Public Clones not available
Private Clones OST290596 (lexicon)
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000410971 (Chr9:63985613..63985923 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCCTGATGCTGACACTTCT Chr9:63985690..63985709 60.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000410971 (Chr9:63985613..63985923 +)
Downstram Exon
ENSMUSE00000718716 (Chr9:63985716..63985912 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCCTGATGCTGACACTTCT Chr9:63985690..63985709 60.42 55 AGAGGAGATCCCGTCTCAGC Chr9:63985746..63985765 60.9 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000356415 Chr9:63964954..63965107 GCCCAGGAGTCATTCAGAGA Chr9:63965032..63965051 60.35 55
upstream ENSMUSE00000344302 Chr9:63965422..63965655 CATGGAGGAAGGTGAGGTGT Chr9:63965520..63965539 59.96 55
upstream ENSMUSE00000377548 Chr9:63966587..63966750 GGCAGTTCTGCCTACCAGAC Chr9:63966604..63966623 59.87 60
upstream ENSMUSE00000219425 Chr9:63967235..63967322 TCAGCCACTACCGATTTTCC Chr9:63967266..63967285 60.07 50
upstream ENSMUSE00000219431 Chr9:63967546..63967655 AGCGATTTCATTGACGCTCT Chr9:63967581..63967600 59.99 45
upstream ENSMUSE00000719836 Chr9:63969413..63969487 CCTCCTGCATCTACCTCCTG Chr9:63969452..63969471 59.82 60
upstream ENSMUSE00000422538 Chr9:63969913..63970041 TGAAGCATTGGCTCACATTC Chr9:63970010..63970029 59.81 45
upstream ENSMUSE00000219433 Chr9:63970130..63970225 ATGTGGCTGCACACCATATC Chr9:63970200..63970219 59.4 50
upstream ENSMUSE00000219426 Chr9:63974508..63974562 TAATAACACGTGGCGCAGCA Chr9:63974534..63974553 63.58 50
upstream ENSMUSE00000219424 Chr9:63974645..63974806 GGCTGCTGAGCGATACCTAC Chr9:63974715..63974734 60.01 60
upstream ENSMUSE00000323214 Chr9:63979357..63979631 CCCCATGGCTCTATTCTGTG Chr9:63979576..63979595 60.47 55
upstream ENSMUSE00000219441 Chr9:63980610..63980736 AGTACGGTGACCCTCCCATA Chr9:63980614..63980633 59.28 55
upstream ENSMUSE00000332982 Chr9:63980905..63981104 CTATCCCAAGGCTTCTGTGC Chr9:63981035..63981054 59.84 55
upstream ENSMUSE00000406376 Chr9:63982659..63982722 GAAAGTTGGCGTCTCAAAGC Chr9:63982662..63982681 60 50

*** Putative Vector Insertion (Chr 9: 63985612 - 63985913) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000410971 Chr9:63985613..63985923 CTGTGGGGACCACAATCTCT Chr9:63985666..63985685 59.96 55
downstream ENSMUSE00000718716 Chr9:63985716..63985912 AGAGGAGATCCCGTCTCAGC Chr9:63985746..63985765 60.9 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCAGAGCCCTTGCTTAGG Chr9:63985608..63985628 59.59 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTCAGAGCCCTTGCTTAGG Chr9:63985608..63985628 59.59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032401