Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22606
Trapped Gene
Pdcd2l (ENSMUSG00000002635)
Vector Insertion
Chr 7: 34969654 - 34969831
Public Clones not available
Private Clones OST290435 (lexicon)
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000384650 (Chr7:34969655..34969830 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000384650 (Chr7:34969655..34969830 -)
Downstram Exon
ENSMUSE00000675497 (Chr7:34969655..34969830 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000238509 Chr7:34981555..34981669 No primer for this exon
upstream ENSMUSE00000238500 Chr7:34981291..34981457 No primer for this exon
upstream ENSMUSE00000238490 Chr7:34981085..34981145 No primer for this exon
upstream ENSMUSE00000199875 Chr7:34977755..34978125 No primer for this exon
upstream ENSMUSE00000199873 Chr7:34974368..34974475 No primer for this exon
upstream ENSMUSE00000199872 Chr7:34971313..34971461 No primer for this exon
upstream ENSMUSE00000384650 Chr7:34969655..34969830 No primer for this exon
upstream ENSMUSE00000675497 Chr7:34969655..34969830 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTAATCGCCTTGCAGCAC Chr7:34969763..34969783 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGAGCGTGACTGGGAAAAC Chr7:34969765..34969785 60.83 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002635