Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22613
Trapped Gene
Zfp110 (ENSMUSG00000058638)
Vector Insertion
Chr 7: 13420877 - 13421641
Public Clones not available
Private Clones OST290040 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000425912 (Chr7:13420796..13420876 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGGACAGTATGGCTTCCA Chr7:13420834..13420853 60.07 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000425912 (Chr7:13420796..13420876 +)
Downstram Exon
ENSMUSE00000537423 (Chr7:13421642..13421768 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGGACAGTATGGCTTCCA Chr7:13420834..13420853 60.07 55 CCACTCTTCCTCGGTAAACG Chr7:13421695..13421714 59.73 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000677124 Chr7:13420410..13420513 GCAGCACCCATCTTCTGTTT Chr7:13420427..13420446 60.26 50
upstream ENSMUSE00000425912 Chr7:13420796..13420876 GGAGGACAGTATGGCTTCCA Chr7:13420834..13420853 60.07 55

*** Putative Vector Insertion (Chr 7: 13420877 - 13421641) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000537423 Chr7:13421642..13421768 CCACTCTTCCTCGGTAAACG Chr7:13421695..13421714 59.73 55
downstream ENSMUSE00000537422 Chr7:13422438..13422533 CAGCAGTCTTCGGCTTTTTC Chr7:13422498..13422517 60.13 50
downstream ENSMUSE00000118545 Chr7:13429781..13430254 CCCATACCCGAAACTTCTCA Chr7:13430179..13430198 59.93 50
downstream ENSMUSE00000198241 Chr7:13432145..13432245 GATCAGTGGCCTCACTGGAG Chr7:13432180..13432199 60.83 60
downstream ENSMUSE00000507369 Chr7:13433321..13433447 CTGCGTTGGACCTAGTAGCC Chr7:13433395..13433414 59.9 60
downstream ENSMUSE00000512813 Chr7:13433746..13435925 ATGCCCAATAAGGTGTGAGC Chr7:13435232..13435251 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGTATGGCTTCCACGCTTC Chr7:13420841..13420861 60.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGTATGGCTTCCACGCTTC Chr7:13420841..13420861 60.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058638