Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22614
Trapped Gene
Zfp26 (ENSMUSG00000063108)
Vector Insertion
Chr 9: 20249430 - 20250189
Public Clones not available
Private Clones OST290038 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000539231 (Chr9:20250190..20250341 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCCTTGGAATCGCAGAAGA Chr9:20250249..20250268 60.34 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000539231 (Chr9:20250190..20250341 -)
Downstram Exon
ENSMUSE00000496541 (Chr9:20249338..20249429 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCCTTGGAATCGCAGAAGA Chr9:20250249..20250268 60.34 50 TGGTCACCAGAAAGCAGACTT Chr9:20249386..20249406 59.9 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638497 Chr9:20264389..20264436 No primer for this exon
upstream ENSMUSE00000703401 Chr9:20264350..20264390 No primer for this exon
upstream ENSMUSE00000493521 Chr9:20263991..20264105 GTGAGCAGTGGGTGGAATTT Chr9:20264013..20264032 59.97 50
upstream ENSMUSE00000539231 Chr9:20250190..20250341 GTCCTTGGAATCGCAGAAGA Chr9:20250249..20250268 60.34 50

*** Putative Vector Insertion (Chr 9: 20249430 - 20250189) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000496541 Chr9:20249338..20249429 TGGTCACCAGAAAGCAGACTT Chr9:20249386..20249406 59.9 47.62
downstream ENSMUSE00000489433 Chr9:20248703..20248811 No primer for this exon
downstream ENSMUSE00000703400 Chr9:20248703..20249429 CCTCACCACACCCTGATCTT Chr9:20248992..20249011 59.96 55
downstream ENSMUSE00000450954 Chr9:20246624..20246709 GCTGTGTCTCCATGAAGGTG Chr9:20246607..20246626 59.26 55
downstream ENSMUSE00000539228 Chr9:20245773..20245899 TCCTGGGTAAAGTCCACAGC Chr9:20245834..20245853 60.11 55
downstream ENSMUSE00000216691 Chr9:20244636..20244719 CAAGAGATCAGGCTGGGTTT Chr9:20244664..20244683 59.28 50
downstream ENSMUSE00000450949 Chr9:20243966..20244048 CAGTTGCATCCCATTTGACA Chr9:20243944..20243963 60.52 45
downstream ENSMUSE00000638494 Chr9:20242873..20242881 No primer for this exon
downstream ENSMUSE00000638493 Chr9:20242742..20242870 TTTTTCCGGAGTGCACTTTT Chr9:20242828..20242847 59.72 40
downstream ENSMUSE00000638496 Chr9:20239474..20243104 TGAATTCGGAAGTGGGTCTC Chr9:20241416..20241435 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr9:20250120..20250140 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000063108