Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22619
Trapped Gene
Glod5 (ENSMUSG00000031163)
Vector Insertion
Chr X: 7581629 - 7582828
Public Clones CMHD-GT_397C11-3 (cmhd) IST12811C12 (tigm)
Private Clones OST289881 (lexicon) OST289877 (lexicon) OST230138 (lexicon) OST197803 (lexicon)
OST193903 (lexicon) OST110024 (lexicon) OST85773 (lexicon) OST26650 (lexicon)
OST26566 (lexicon) OST25906 (lexicon) OST15931 (lexicon) OST14918 (lexicon)
OST14725 (lexicon) OST8311 (lexicon) OST8144 (lexicon) OST2965 (lexicon)
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000206984 (ChrX:7582829..7582984 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAACCGGAAAGCATTGTGT ChrX:7582964..7582983 59.98 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000206984 (ChrX:7582829..7582984 -)
Downstram Exon
ENSMUSE00000240769 (ChrX:7581327..7581628 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAACCGGAAAGCATTGTGT ChrX:7582964..7582983 59.98 45 TGTCCGGATCTCGGAAGTAG ChrX:7581519..7581538 60.21 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000206988 ChrX:7595543..7595618 TGCCTTCCAGTCTACCAGGA ChrX:7595573..7595592 60.79 55
upstream ENSMUSE00000206987 ChrX:7592344..7592481 CCTTCCCCGTGTCTTATCTG ChrX:7592438..7592457 59.54 55
upstream ENSMUSE00000206984 ChrX:7582829..7582984 GAAACCGGAAAGCATTGTGT ChrX:7582964..7582983 59.98 45

*** Putative Vector Insertion (Chr X: 7581629 - 7582828) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000240769 ChrX:7581327..7581628 TGTCCGGATCTCGGAAGTAG ChrX:7581519..7581538 60.21 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGAGTAATCGCCTTGCAG ChrX:7582763..7582783 60.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAAATACTCTGGAGCGTGA ChrX:7582772..7582792 59.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TACACGTAATCGCCTTGCAG ChrX:7582920..7582940 59.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TAAACAGGGAAACCGGAAAG ChrX:7582970..7582990 59.06 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031163