Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22626
Trapped Gene
Ppcdc (ENSMUSG00000063849)
Vector Insertion
Chr 9: 57285290 - 57287876
Public Clones (sanger) (sanger) D059H02 (ggtc) (ggtc) D059H02 (ggtc) IST14664F5 (tigm)
IST12901D9 (tigm) IST14508H3 (tigm)
Private Clones OST289802 (lexicon) OST287648 (lexicon) OST236527 (lexicon) OST199679 (lexicon)
OST157944 (lexicon) OST144171 (lexicon) OST73629 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000474456 (Chr9:57287877..57287921 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACTTGCGGGTATCCTGGAG Chr9:57287880..57287899 60.09 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000474456 (Chr9:57287877..57287921 -)
Downstram Exon
ENSMUSE00000473445 (Chr9:57285224..57285289 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACTTGCGGGTATCCTGGAG Chr9:57287880..57287899 60.09 55 CCCGTTGTCCTTCTTCAGTC Chr9:57285224..57285243 59.7 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000474456 Chr9:57287877..57287921 TACTTGCGGGTATCCTGGAG Chr9:57287880..57287899 60.09 55

*** Putative Vector Insertion (Chr 9: 57285290 - 57287876) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000473445 Chr9:57285224..57285289 CCCGTTGTCCTTCTTCAGTC Chr9:57285224..57285243 59.7 55
downstream ENSMUSE00000472416 Chr9:57282710..57282892 CCTTTGGTTCCATGTGAGGT Chr9:57282810..57282829 59.82 50
downstream ENSMUSE00000421873 Chr9:57268933..57269028 CCATTCATCAGCGTCACTGT Chr9:57268914..57268933 59.71 50
downstream ENSMUSE00000421597 Chr9:57267970..57268098 GGAGCCACTAGCATGAGGTC Chr9:57268003..57268022 59.83 60
downstream ENSMUSE00000469843 Chr9:57262893..57263061 GGAATCTCCACGTAGCCAAA Chr9:57262906..57262925 60.07 50
downstream ENSMUSE00000534256 Chr9:57260475..57262533 TTACCTGGTCAACCGTAGCC Chr9:57260522..57260541 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCTGGTGAGCAGTGGAAG Chr9:57287861..57287881 61.15 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTGGTGAGCAGTGGAAG Chr9:57287861..57287881 61.15 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCTGGAGCTGGTGATAATCG Chr9:57287865..57287885 60.62 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGTGACGTGACTGGGAAAAC Chr9:57287856..57287876 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063849