Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22644
Trapped Gene
Ptms (ENSMUSG00000030122)
Vector Insertion
Chr 6: 124864251 - 124864425
Public Clones not available
Private Clones OST289131 (lexicon) OST282641 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000195499 (Chr6:124864426..124864484 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGGAAGAGAACTGCTGAAG Chr6:124864431..124864450 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000195499 (Chr6:124864426..124864484 -)
Downstram Exon
ENSMUSE00000651453 (Chr6:124863699..124864250 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGGAAGAGAACTGCTGAAG Chr6:124864431..124864450 60.28 55 GAGGGAATCTGAGGGAGACC Chr6:124863789..124863808 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000651454 Chr6:124867578..124867964 No primer for this exon
upstream ENSMUSE00000718585 Chr6:124867578..124867964 No primer for this exon
upstream ENSMUSE00000195495 Chr6:124864936..124865007 CGGAAAGAACGGAAGAAAGA Chr6:124864946..124864965 59.42 45
upstream ENSMUSE00000195494 Chr6:124864653..124864731 GGATGATGATGAAGGGGATG Chr6:124864659..124864678 60.1 50
upstream ENSMUSE00000195499 Chr6:124864426..124864484 GCGGAAGAGAACTGCTGAAG Chr6:124864431..124864450 60.28 55
upstream ENSMUSE00000691709 Chr6:124864426..124864487 GCGGAAGAGAACTGCTGAAG Chr6:124864431..124864450 60.28 55

*** Putative Vector Insertion (Chr 6: 124864251 - 124864425) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000691708 Chr6:124863701..124864250 GAGGGAATCTGAGGGAGACC Chr6:124863789..124863808 60.01 60
downstream ENSMUSE00000651453 Chr6:124863699..124864250 GAGGGAATCTGAGGGAGACC Chr6:124863789..124863808 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGAGGGGCTGTCAGGAATA Chr6:124864385..124864405 60.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGAGGGGCTGTCAGGAATA Chr6:124864385..124864405 60.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030122