Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22651
Trapped Gene
Sept6 (ENSMUSG00000050379)
Vector Insertion
Chr X: 34486562 - 34486750
Public Clones not available
Private Clones OST288964 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000702124 (ChrX:34486563..34486749 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTACAAGCCCATCGTGGAAT ChrX:34486730..34486749 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000702124 (ChrX:34486563..34486749 -)
Downstram Exon
ENSMUSE00000393823 (ChrX:34486563..34486749 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTACAAGCCCATCGTGGAAT ChrX:34486730..34486749 59.96 50 ATTCCACGATGGGCTTGTAG ChrX:34486708..34486727 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702129 ChrX:34531671..34531684 No primer for this exon
upstream ENSMUSE00000404329 ChrX:34529374..34529476 GAGCTCTTCTGTTTCCTGTGC ChrX:34529456..34529476 59.23 52.38
upstream ENSMUSE00000556212 ChrX:34529374..34529476 GAGCTCTTCTGTTTCCTGTGC ChrX:34529456..34529476 59.23 52.38
upstream ENSMUSE00000702133 ChrX:34529374..34529651 CGGAGGAGCTCTTCTGTTTC ChrX:34529462..34529481 59.16 55
upstream ENSMUSE00000702141 ChrX:34515432..34515447 No primer for this exon
upstream ENSMUSE00000702140 ChrX:34515407..34515417 No primer for this exon
upstream ENSMUSE00000333166 ChrX:34515058..34515172 GGCGAAGATTGTCGAACTGT ChrX:34515153..34515172 60.26 50
upstream ENSMUSE00000702139 ChrX:34515058..34515172 GGCGAAGATTGTCGAACTGT ChrX:34515153..34515172 60.26 50
upstream ENSMUSE00000702138 ChrX:34506591..34506786 CGCTCATGGATACCCTGTTT ChrX:34506743..34506762 59.96 50
upstream ENSMUSE00000708801 ChrX:34506591..34506786 CGCTCATGGATACCCTGTTT ChrX:34506743..34506762 59.96 50
upstream ENSMUSE00000721151 ChrX:34506591..34506786 CGCTCATGGATACCCTGTTT ChrX:34506743..34506762 59.96 50
upstream ENSMUSE00000393823 ChrX:34486563..34486749 CTACAAGCCCATCGTGGAAT ChrX:34486730..34486749 59.96 50
upstream ENSMUSE00000702124 ChrX:34486563..34486749 CTACAAGCCCATCGTGGAAT ChrX:34486730..34486749 59.96 50

*** Putative Vector Insertion (Chr X: 34486562 - 34486750) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000344295 ChrX:34482050..34482211 TTGGCAATAACGGGAATGAT ChrX:34482164..34482183 60.15 40
downstream ENSMUSE00000702123 ChrX:34482050..34482211 TTGGCAATAACGGGAATGAT ChrX:34482164..34482183 60.15 40
downstream ENSMUSE00000624312 ChrX:34474379..34474475 CGCATCATCTTGTTGCCTAT ChrX:34474389..34474408 58.75 45
downstream ENSMUSE00000702122 ChrX:34474379..34474475 CGCATCATCTTGTTGCCTAT ChrX:34474389..34474408 58.75 45
downstream ENSMUSE00000624311 ChrX:34470094..34470262 GTTGACCCGAATCAGCATCT ChrX:34470182..34470201 60.08 50
downstream ENSMUSE00000702119 ChrX:34470094..34470262 GTTGACCCGAATCAGCATCT ChrX:34470182..34470201 60.08 50
downstream ENSMUSE00000702115 ChrX:34466777..34466909 TTGAGCTCCGCTTCTTTCTC ChrX:34466771..34466790 59.84 50
downstream ENSMUSE00000702145 ChrX:34466777..34466909 TTGAGCTCCGCTTCTTTCTC ChrX:34466771..34466790 59.84 50
downstream ENSMUSE00000656324 ChrX:34462835..34463025 TTGAAGGCGTTCATTTCCTC ChrX:34462903..34462922 60.19 45
downstream ENSMUSE00000656329 ChrX:34462835..34463025 TTGAAGGCGTTCATTTCCTC ChrX:34462903..34462922 60.19 45
downstream ENSMUSE00000656322 ChrX:34460364..34460408 TGCAGCAAACAGCAGAGTTA ChrX:34460366..34460385 58.37 45
downstream ENSMUSE00000707311 ChrX:34460364..34460408 TGCAGCAAACAGCAGAGTTA ChrX:34460366..34460385 58.37 45
downstream ENSMUSE00000707310 ChrX:34455828..34456540 TGGGGTGTATGCCCTCTAAG ChrX:34456422..34456441 59.95 55
downstream ENSMUSE00000702137 ChrX:34455318..34455342 No primer for this exon
downstream ENSMUSE00000656321 ChrX:34453441..34456540 TGTGAGTCTGGCAGAGATGG ChrX:34456238..34456257 59.98 55
downstream ENSMUSE00000449153 ChrX:34453240..34453249 No primer for this exon
downstream ENSMUSE00000702142 ChrX:34443352..34443358 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA ChrX:34486681..34486701 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCCTACCTACGTGACTGG ChrX:34486690..34486710 59.23 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050379