Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22653
Trapped Gene
Tmub2 (ENSMUSG00000034757)
Vector Insertion
Chr 11: 102147033 - 102148621
Public Clones not available
Private Clones OST288897 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000647408 (Chr11:102146978..102147032 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCTTCGATGATTTCACGTC Chr11:102146991..102147010 59.81 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000647408 (Chr11:102146978..102147032 +)
Downstram Exon
ENSMUSE00000344091 (Chr11:102148622..102149185 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCTTCGATGATTTCACGTC Chr11:102146991..102147010 59.81 45 CCCCACTGTCACTGGTCTCT Chr11:102148938..102148957 60.15 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672210 Chr11:102146245..102146402 TCCTGGCGAAGTCAAAACAT Chr11:102146365..102146384 60.64 45
upstream ENSMUSE00000647409 Chr11:102146254..102146402 TCCTGGCGAAGTCAAAACAT Chr11:102146365..102146384 60.64 45
upstream ENSMUSE00000647408 Chr11:102146978..102147032 TGCTTCGATGATTTCACGTC Chr11:102146991..102147010 59.81 45
upstream ENSMUSE00000672211 Chr11:102146998..102147032 No primer for this exon

*** Putative Vector Insertion (Chr 11: 102147033 - 102148621) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000344091 Chr11:102148622..102149185 CCCCACTGTCACTGGTCTCT Chr11:102148938..102148957 60.15 60
downstream ENSMUSE00000408478 Chr11:102149390..102150551 GGGGGTTAGGGAACAGACAT Chr11:102150084..102150103 60.05 55
downstream ENSMUSE00000672216 Chr11:102149390..102150549 GGGGGTTAGGGAACAGACAT Chr11:102150084..102150103 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr11:102147084..102147104 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000034757