Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22656
Trapped Gene
Pcnp (ENSMUSG00000071533)
Vector Insertion
Chr 16: 56024336 - 56024552
Public Clones not available
Private Clones OST288802 (lexicon) OST43334 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720388 (Chr16:56024337..56024741 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATGGAGGGGAAAGTTCCAG Chr16:56024479..56024498 60.3 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720388 (Chr16:56024337..56024741 -)
Downstram Exon
ENSMUSE00000618093 (Chr16:56024337..56024551 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATGGAGGGGAAAGTTCCAG Chr16:56024479..56024498 60.3 50 AGGTCTGCAGCTTCGTCTTC Chr16:56024412..56024431 59.75 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000655002 Chr16:56029716..56029830 GGGAGAGGAGAAGCCAGAGA Chr16:56029743..56029762 61.01 60
upstream ENSMUSE00000717002 Chr16:56029716..56029809 GGGAGAGGAGAAGCCAGAGA Chr16:56029743..56029762 61.01 60
upstream ENSMUSE00000699358 Chr16:56024647..56024781 GCCTCTTGTACTGCCACACA Chr16:56024718..56024737 59.9 55
upstream ENSMUSE00000618093 Chr16:56024337..56024551 AATGGAGGGGAAAGTTCCAG Chr16:56024479..56024498 60.3 50
upstream ENSMUSE00000720388 Chr16:56024337..56024741 AATGGAGGGGAAAGTTCCAG Chr16:56024479..56024498 60.3 50

*** Putative Vector Insertion (Chr 16: 56024336 - 56024552) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000618092 Chr16:56022168..56022242 GCTGCTGCTACCGACAGAGT Chr16:56022165..56022184 60.76 60
downstream ENSMUSE00000618091 Chr16:56018585..56018640 TCTTTGCTTCTGGAGGCATT Chr16:56018585..56018604 59.96 45
downstream ENSMUSE00000718790 Chr16:56018233..56018640 TCTTTGCTTCTGGAGGCATT Chr16:56018585..56018604 59.96 45
downstream ENSMUSE00000699357 Chr16:56017304..56017430 GTCTTGGTCGTGGACGTTTC Chr16:56017288..56017307 60.56 55
downstream ENSMUSE00000699366 Chr16:56015621..56017430 CTAGAATGGCCCGAAACAAA Chr16:56016719..56016738 60.07 45
downstream ENSMUSE00000717074 Chr16:56007358..56007595 GCAGAGTGAGTGCTGCTGTC Chr16:56007408..56007427 59.93 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGTTTCGACTTCACCAGGA Chr16:56024548..56024568 59.26 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTTTCGACTTCACCAGGA Chr16:56024548..56024568 59.26 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071533