Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22662
Trapped Gene
Ddx59 (ENSMUSG00000026404)
Vector Insertion
Chr 1: 138329141 - 138330289
Public Clones not available
Private Clones OST288658 (lexicon)
Severity of mutation (?) Insertion after 71% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000234131 (Chr1:138328889..138329140 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGTGCTTGACGTTTTGGA Chr1:138328922..138328941 59.88 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000234131 (Chr1:138328889..138329140 +)
Downstram Exon
ENSMUSE00000234123 (Chr1:138330290..138330442 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGTGCTTGACGTTTTGGA Chr1:138328922..138328941 59.88 45 ATCTGCGCCTAGTTTGCAGT Chr1:138330352..138330371 60.04 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000234159 Chr1:138311848..138312000 No primer for this exon
upstream ENSMUSE00000234151 Chr1:138313159..138313973 ACCCTCAAGGAGGACCAGAT Chr1:138313695..138313714 59.93 55
upstream ENSMUSE00000158758 Chr1:138315987..138316154 TTCTCGTAGGGGGCTTACCT Chr1:138316096..138316115 60.09 55
upstream ENSMUSE00000234138 Chr1:138321372..138321461 ATAGCAACCCCTGGACGACT Chr1:138321378..138321397 60.9 55
upstream ENSMUSE00000234131 Chr1:138328889..138329140 CAAGTGCTTGACGTTTTGGA Chr1:138328922..138328941 59.88 45

*** Putative Vector Insertion (Chr 1: 138329141 - 138330289) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000234123 Chr1:138330290..138330442 ATCTGCGCCTAGTTTGCAGT Chr1:138330352..138330371 60.04 50
downstream ENSMUSE00000234115 Chr1:138331083..138331211 TGCTCACCACGACCTCATAG Chr1:138331122..138331141 59.85 55
downstream ENSMUSE00000234109 Chr1:138336330..138336728 TCCATTTTGACCGAGTCTCC Chr1:138336365..138336384 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTCAGCCATGTTTTGTCG Chr1:138329155..138329175 60.3 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTCAGCCATGTTTTGTCG Chr1:138329155..138329175 60.3 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026404