Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22678
Trapped Gene
St3gal2 (ENSMUSG00000031749)
Vector Insertion
Chr 8: 113493443 - 113493564
Public Clones not available
Private Clones OST288111 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000720465 (Chr8:113493444..113493723 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGTAGGCAGTCGGTGTTGT Chr8:113493562..113493581 59.65 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000720465 (Chr8:113493444..113493723 +)
Downstram Exon
ENSMUSE00000310144 (Chr8:113493444..113493563 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGTAGGCAGTCGGTGTTGT Chr8:113493562..113493581 59.65 55 GGCTGGGTTGTAAATCTGGA Chr8:113493467..113493486 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000439990 Chr8:113443822..113444005 ACTGGAGAGCGGTGAAGCTA Chr8:113443860..113443879 60.16 55
upstream ENSMUSE00000310174 Chr8:113480658..113481950 TGGCTTAGAGTCTGGCACCT Chr8:113480852..113480871 60.01 55
upstream ENSMUSE00000212665 Chr8:113486069..113486262 ACAACACCAACGAAGTGCTG Chr8:113486094..113486113 59.79 50
upstream ENSMUSE00000310161 Chr8:113491317..113491496 GGCTTTGAGAAGGATGTTGG Chr8:113491339..113491358 59.67 50
upstream ENSMUSE00000310155 Chr8:113493088..113493133 CCTTCCTTCGAGTGGACAAA Chr8:113493108..113493127 60.22 50

*** Putative Vector Insertion (Chr 8: 113493443 - 113493564) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000310144 Chr8:113493444..113493563 GGCTGGGTTGTAAATCTGGA Chr8:113493467..113493486 59.93 50
downstream ENSMUSE00000720465 Chr8:113493444..113493723 GGCTGGGTTGTAAATCTGGA Chr8:113493467..113493486 59.93 50
downstream ENSMUSE00000351245 Chr8:113494002..113496380 GAGAAGCACCTTGCATGTGA Chr8:113494667..113494686 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000031749