Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22699
Trapped Gene
Tmem40 (ENSMUSG00000059900)
Vector Insertion
Chr 6: 115679703 - 115680453
Public Clones CMHD-GT_396G9-3 (cmhd) IST10022D1 (tigm)
Private Clones OST287490 (lexicon) OST287488 (lexicon) OST286063 (lexicon) OST126794 (lexicon)
Severity of mutation (?) Insertion after 97% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000309087 (Chr6:115680454..115680516 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCCCCCTCCTTCAGAAGTT Chr6:115680465..115680484 59 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000309087 (Chr6:115680454..115680516 -)
Downstram Exon
ENSMUSE00000693719 (Chr6:115679159..115679702 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCCCCCTCCTTCAGAAGTT Chr6:115680465..115680484 59 50 CAGCGTCTTACCTGCAACAA Chr6:115679226..115679245 60.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000693720 Chr6:115708956..115708979 No primer for this exon
upstream ENSMUSE00000693728 Chr6:115708956..115709289 ACACACAGCTCACCTTGCAG Chr6:115708980..115708999 60.1 55
upstream ENSMUSE00000379382 Chr6:115692328..115692405 CAGGGAAACGGAAGATCACT Chr6:115692328..115692347 59.14 50
upstream ENSMUSE00000693727 Chr6:115692328..115692405 CAGGGAAACGGAAGATCACT Chr6:115692328..115692347 59.14 50
upstream ENSMUSE00000309154 Chr6:115691559..115691690 GAGACAGAGCTCCACAAGCA Chr6:115691666..115691685 59.29 55
upstream ENSMUSE00000309144 Chr6:115688966..115689040 GAGGTCCCAGGAAACACAGA Chr6:115688994..115689013 60.09 55
upstream ENSMUSE00000309135 Chr6:115686401..115686454 GGGGAACTGGAAGTGCTAAA Chr6:115686424..115686443 59.17 50
upstream ENSMUSE00000309129 Chr6:115684828..115684863 No primer for this exon
upstream ENSMUSE00000309120 Chr6:115684013..115684045 GACTCCGAAGGAGAGGTTCC Chr6:115684026..115684045 60.19 60
upstream ENSMUSE00000309113 Chr6:115683672..115683719 No primer for this exon
upstream ENSMUSE00000309102 Chr6:115681203..115681274 AGCCTTGCTGGTGTGTTACC Chr6:115681215..115681234 60.18 55
upstream ENSMUSE00000309091 Chr6:115681025..115681099 TCTCGAGACCATTGGCATCT Chr6:115681037..115681056 60.77 50
upstream ENSMUSE00000309087 Chr6:115680454..115680516 ATCCCCCTCCTTCAGAAGTT Chr6:115680465..115680484 59 50

*** Putative Vector Insertion (Chr 6: 115679703 - 115680453) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000693719 Chr6:115679159..115679702 CAGCGTCTTACCTGCAACAA Chr6:115679226..115679245 60.05 50
downstream ENSMUSE00000693723 Chr6:115679149..115679702 CAGCGTCTTACCTGCAACAA Chr6:115679226..115679245 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTCATCCCCCTCCTTCAGA Chr6:115680467..115680487 61.5 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCATCCCCCTCCTTCAGA Chr6:115680467..115680487 61.5 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ACCAACATTTCCCCCTTGTT Chr6:115680525..115680545 60.46 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACCAACATTTCCCCCTTGTT Chr6:115680525..115680545 60.46 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059900