Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22700
Trapped Gene
Cryzl1 (ENSMUSG00000058240)
Vector Insertion
Chr 16: 91717721 - 91728802
Public Clones (sanger) (sanger) D134C10 (ggtc) IST14398A5 (tigm) IST14439G2 (tigm)
IST14158G12 (tigm) IST14992G4 (tigm) IST14874E7 (tigm)
Private Clones OST287475 (lexicon) OST257633 (lexicon) OST40388 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000710891 (Chr16:91728803..91728868 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGCAGAAGGACTGGGAAG Chr16:91728848..91728867 60.52 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000710891 (Chr16:91728803..91728868 -)
Downstram Exon
ENSMUSE00000248331 (Chr16:91717649..91717720 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGCAGAAGGACTGGGAAG Chr16:91728848..91728867 60.52 55 TCTGTTGAAAATACAAGCCTTTCA Chr16:91717668..91717691 60.16 33.33

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697795 Chr16:91728803..91728871 GCTCTCTGCAGAAGGACTGG Chr16:91728852..91728871 60.28 60
upstream ENSMUSE00000710891 Chr16:91728803..91728868 TCTGCAGAAGGACTGGGAAG Chr16:91728848..91728867 60.52 55
upstream ENSMUSE00000712965 Chr16:91728803..91729047 GTAGTTCCGGGTTCAGTTGC Chr16:91728967..91728986 59.6 55

*** Putative Vector Insertion (Chr 16: 91717721 - 91728802) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000248331 Chr16:91717649..91717720 TCTGTTGAAAATACAAGCCTTTCA Chr16:91717668..91717691 60.16 33.33
downstream ENSMUSE00000708836 Chr16:91717649..91717720 TCTGTTGAAAATACAAGCCTTTCA Chr16:91717668..91717691 60.16 33.33
downstream ENSMUSE00000132148 Chr16:91714994..91715071 No primer for this exon
downstream ENSMUSE00000132153 Chr16:91712440..91712512 TTCCAACAGGGAAGAAATCC Chr16:91712445..91712464 58.96 45
downstream ENSMUSE00000132150 Chr16:91709074..91709118 ACTTCGTCGTCTGGCTGAAA Chr16:91709057..91709076 60.97 50
downstream ENSMUSE00000132149 Chr16:91707470..91707538 TCGGAATCCAAAGGCAGAAT Chr16:91707495..91707514 61.84 45
downstream ENSMUSE00000132151 Chr16:91701317..91701450 CTTCCGTCCATGACACCTTT Chr16:91701396..91701415 59.97 50
downstream ENSMUSE00000248300 Chr16:91699422..91699533 CTCCTCTGTGGTGGGCTAAC Chr16:91699469..91699488 59.72 60
downstream ENSMUSE00000248291 Chr16:91695506..91695604 TCCTCCAAACAGCTTTCAGC Chr16:91695525..91695544 60.52 50
downstream ENSMUSE00000697794 Chr16:91694891..91694910 No primer for this exon
downstream ENSMUSE00000248285 Chr16:91694427..91694545 CCTCCGACACCAAGAAGTGT Chr16:91694436..91694455 60.15 55
downstream ENSMUSE00000354156 Chr16:91692844..91692949 TTCCCTGTTGTGCATTTGAC Chr16:91692831..91692850 59.55 45
downstream ENSMUSE00000364839 Chr16:91690949..91690994 CCAGCTGATAACTTCTCCATCA Chr16:91690936..91690957 59.34 45.46
downstream ENSMUSE00000708846 Chr16:91689851..91690160 TCCGACTGAGATCAGGGAAG Chr16:91690015..91690034 60.34 55
downstream ENSMUSE00000408995 Chr16:91689705..91690160 TCCGACTGAGATCAGGGAAG Chr16:91690015..91690034 60.34 55
downstream ENSMUSE00000716435 Chr16:91689587..91690160 AATGGCATCAACGGTTTGTT Chr16:91689616..91689635 60.24 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGGAAGAACGATGTGTGT Chr16:91725775..91725795 58.57 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGGAAGAACGATGTGTGT Chr16:91725775..91725795 58.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CAGTGGGCAAAGAGTCTGCT Chr16:91725872..91725892 60.59 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAGTGGGCAAAGAGTCTGCT Chr16:91725872..91725892 60.59 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058240