Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22706
Trapped Gene
4931406C07Rik (ENSMUSG00000031938)
Vector Insertion
Chr 9: 15105958 - 15110480
Public Clones IST14852C3 (tigm) IST14335F6 (tigm) IST14424G7 (tigm) IST14852C3 (tigm)
Private Clones OST287267 (lexicon) OST124260 (lexicon) OST104682 (lexicon) OST68902 (lexicon)
OST61450 (lexicon) OST57055 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000428179 (Chr9:15110481..15110584 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGTTCGAACCTGAGTGGA Chr9:15110521..15110540 60.28 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000428179 (Chr9:15110481..15110584 -)
Downstram Exon
ENSMUSE00000214833 (Chr9:15105811..15105957 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGTTCGAACCTGAGTGGA Chr9:15110521..15110540 60.28 50 CAGCAAGCTCCTCCAGACTT Chr9:15105792..15105811 59.74 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000428179 Chr9:15110481..15110584 TGTGTTCGAACCTGAGTGGA Chr9:15110521..15110540 60.28 50

*** Putative Vector Insertion (Chr 9: 15105958 - 15110480) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214833 Chr9:15105811..15105957 CAGCAAGCTCCTCCAGACTT Chr9:15105792..15105811 59.74 55
downstream ENSMUSE00000214832 Chr9:15102287..15102385 AAATCTGGGCAGTCAACCAC Chr9:15102297..15102316 59.97 50
downstream ENSMUSE00000214837 Chr9:15099130..15099203 GGCACACCTCCTACTTCTGC Chr9:15099139..15099158 59.87 60
downstream ENSMUSE00000214838 Chr9:15098876..15098977 CAAGCGTCTGAAATGGACCT Chr9:15098868..15098887 60.26 50
downstream ENSMUSE00000214835 Chr9:15096444..15096620 GCCAGTAGTGCACATCCAAA Chr9:15096456..15096475 59.72 50
downstream ENSMUSE00000273248 Chr9:15095111..15095260 TTGGCTTGCACTTCAATGAC Chr9:15095219..15095238 59.85 45
downstream ENSMUSE00000214836 Chr9:15091800..15091916 AACCAAGGGAGCCTTCATCT Chr9:15091808..15091827 60.07 50
downstream ENSMUSE00000355349 Chr9:15087783..15089435 AGCCATCAGCGCTCAGTAAT Chr9:15088019..15088038 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGACTGTCCTGTGCTGTGA Chr9:15107469..15107489 58.96 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTCCGTGACTGGGAAAAC Chr9:15107414..15107434 59.7 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AGTGAGGGACCCACTTTTCA Chr9:15107605..15107625 59.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCAGAAAAGACTGGCAGGAGA Chr9:15107546..15107567 60.12 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031938