Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22720
Trapped Gene
Zfp760 (ENSMUSG00000067928)
Vector Insertion
Chr 17: 21844861 - 21845577
Public Clones (sanger)
Private Clones OST286671 (lexicon) OST149091 (lexicon) OST126435 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000703335 (Chr17:21844702..21844860 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACTGGAGCCTCGTAGAAC Chr17:21844748..21844767 59.87 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000703335 (Chr17:21844702..21844860 +)
Downstram Exon
ENSMUSE00000703341 (Chr17:21845578..21845689 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACTGGAGCCTCGTAGAAC Chr17:21844748..21844767 59.87 60 GTTCACCGCATGTCAACAAC Chr17:21845601..21845620 60.02 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703335 Chr17:21844702..21844860 CCACTGGAGCCTCGTAGAAC Chr17:21844748..21844767 59.87 60
upstream ENSMUSE00000703342 Chr17:21844708..21844860 CCACTGGAGCCTCGTAGAAC Chr17:21844748..21844767 59.87 60

*** Putative Vector Insertion (Chr 17: 21844861 - 21845577) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000703341 Chr17:21845578..21845689 GTTCACCGCATGTCAACAAC Chr17:21845601..21845620 60.02 50
downstream ENSMUSE00000703340 Chr17:21846172..21846263 ACTTTGTCCTGCTCGACGAT Chr17:21846222..21846241 59.87 50
downstream ENSMUSE00000703334 Chr17:21846188..21846263 ACTTTGTCCTGCTCGACGAT Chr17:21846222..21846241 59.87 50
downstream ENSMUSE00000703337 Chr17:21856014..21856089 TCTCAAGAACAATGGCTGGA Chr17:21856047..21856066 59.37 45
downstream ENSMUSE00000554367 Chr17:21857911..21858037 ATCCCCGAATGTCAACAGAC Chr17:21857934..21857953 59.79 50
downstream ENSMUSE00000472711 Chr17:21858955..21862596 TTTGGGACTTCCAGGCTATG Chr17:21861206..21861225 60.07 50
downstream ENSMUSE00000703333 Chr17:21859322..21859452 ACTGAGGCTTGAGCAACTCC Chr17:21859403..21859422 59.6 55
downstream ENSMUSE00000703332 Chr17:21860065..21862596 TTTGGGACTTCCAGGCTATG Chr17:21861206..21861225 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCATCTCCCAGGTCAGAAGA Chr17:21844828..21844848 60.35 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCATCTCCCAGGTCAGAAGA Chr17:21844828..21844848 60.35 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000067928