Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22726
Trapped Gene
Nde1 (ENSMUSG00000022678)
Vector Insertion
Chr 16: 14170585 - 14175383
Public Clones not available
Private Clones OST286220 (lexicon) OST262260 (lexicon) OST195726 (lexicon) OST56092 (lexicon)
OST42914 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000704197 (Chr16:14170431..14170584 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCCGAGAATACGAAGCTGA Chr16:14170474..14170493 60.12 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000704197 (Chr16:14170431..14170584 +)
Downstram Exon
ENSMUSE00000129431 (Chr16:14175384..14175532 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCCGAGAATACGAAGCTGA Chr16:14170474..14170493 60.12 50 AGATCTGCCGGTAACCCTCT Chr16:14175429..14175448 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710851 Chr16:14163380..14163461 No primer for this exon
upstream ENSMUSE00000396125 Chr16:14163399..14163461 No primer for this exon
upstream ENSMUSE00000360932 Chr16:14169545..14169668 CCTGGCCATGACCTACAAAC Chr16:14169645..14169664 60.38 55
upstream ENSMUSE00000710553 Chr16:14169545..14169668 CCTGGCCATGACCTACAAAC Chr16:14169645..14169664 60.38 55
upstream ENSMUSE00000704198 Chr16:14169568..14169668 TGGCCATGACCTACAAACAG Chr16:14169647..14169666 59.57 50
upstream ENSMUSE00000563156 Chr16:14170431..14170584 AGCCGAGAATACGAAGCTGA Chr16:14170474..14170493 60.12 50
upstream ENSMUSE00000704197 Chr16:14170431..14170584 AGCCGAGAATACGAAGCTGA Chr16:14170474..14170493 60.12 50

*** Putative Vector Insertion (Chr 16: 14170585 - 14175383) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000129431 Chr16:14175384..14175532 AGATCTGCCGGTAACCCTCT Chr16:14175429..14175448 60.1 55
downstream ENSMUSE00000563152 Chr16:14183569..14183705 CTTGATTCAAACGCTGCTCA Chr16:14183618..14183637 60.13 45
downstream ENSMUSE00000704196 Chr16:14183569..14183705 CTTGATTCAAACGCTGCTCA Chr16:14183618..14183637 60.13 45
downstream ENSMUSE00000129434 Chr16:14185787..14185966 AGACGGTACAGAGCCTGTGG Chr16:14185908..14185927 60.32 60
downstream ENSMUSE00000129433 Chr16:14188406..14188497 CAGGTCCCCAACGATGTTTA Chr16:14188485..14188504 60.74 50
downstream ENSMUSE00000129429 Chr16:14190180..14190325 TTTTGGTTCCTCGTCCTGAG Chr16:14190276..14190295 60.22 50
downstream ENSMUSE00000704199 Chr16:14191683..14191695 No primer for this exon
downstream ENSMUSE00000388059 Chr16:14191811..14192921 ACCACCCTGGTTGCTCTATG Chr16:14192582..14192601 59.99 55
downstream ENSMUSE00000704195 Chr16:14191811..14192659 ACCACCCTGGTTGCTCTATG Chr16:14192582..14192601 59.99 55
downstream ENSMUSE00000717321 Chr16:14192435..14192921 CCCTGGTTGCTCTATGGTGT Chr16:14192578..14192597 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTAATCGCCTTGCAGCACAT Chr16:14173634..14173655 62.52 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGCTGGAGTCTGTGAAGG Chr16:14173567..14173587 59.99 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022678