Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22728
Trapped Gene
Meis1 (ENSMUSG00000020160)
Vector Insertion
Chr 11: 18805769 - 18841661
Public Clones IST11893E3 (tigm)
Private Clones OST286195 (lexicon)
Severity of mutation (?) Insertion after 55% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000655363 (Chr11:18841662..18841807 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000655363 (Chr11:18841662..18841807 -)
Downstram Exon
ENSMUSE00000655362 (Chr11:18805692..18805768 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662889 Chr11:18918224..18918964 No primer for this exon
upstream ENSMUSE00000662888 Chr11:18916136..18916362 No primer for this exon
upstream ENSMUSE00000655368 Chr11:18914253..18914394 No primer for this exon
upstream ENSMUSE00000655367 Chr11:18913635..18913685 No primer for this exon
upstream ENSMUSE00000655366 Chr11:18912813..18912863 No primer for this exon
upstream ENSMUSE00000714519 Chr11:18911979..18912005 No primer for this exon
upstream ENSMUSE00000655365 Chr11:18911245..18911391 No primer for this exon
upstream ENSMUSE00000655364 Chr11:18888271..18888382 No primer for this exon
upstream ENSMUSE00000655363 Chr11:18841662..18841807 No primer for this exon

*** Putative Vector Insertion (Chr 11: 18805769 - 18841661) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000655362 Chr11:18805692..18805768 No primer for this exon
downstream ENSMUSE00000662887 Chr11:18785596..18785654 No primer for this exon
downstream ENSMUSE00000662886 Chr11:18784390..18784479 No primer for this exon
downstream ENSMUSE00000594002 Chr11:18783991..18784085 No primer for this exon
downstream ENSMUSE00000655359 Chr11:18780686..18781925 No primer for this exon
downstream ENSMUSE00000662885 Chr11:18780686..18781925 No primer for this exon
downstream ENSMUSE00000718905 Chr11:18780674..18781925 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr11:18832591..18832611 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTACGTGACTGGGAAAACC Chr11:18835594..18835614 59.45 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GATTGTTTAATCGCCTTGCAG Chr11:18835743..18835764 59.73 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCTTCGTGACTGGGAAAACC Chr11:18835741..18835761 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020160