Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22747
Trapped Gene
Emp1 (ENSMUSG00000030208)
Vector Insertion
Chr 6: 135327195 - 135327307
Public Clones not available
Private Clones OST285746 (lexicon) OST215542 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000361181 (Chr6:135327196..135327306 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTGCCACTGCCATTATGCT Chr6:135327265..135327284 60.5 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000361181 (Chr6:135327196..135327306 +)
Downstram Exon
ENSMUSE00000717068 (Chr6:135327196..135327306 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTGCCACTGCCATTATGCT Chr6:135327265..135327284 60.5 45 CCACAAAGAGACCAGCCAGT Chr6:135327262..135327281 60.3 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000382479 Chr6:135312949..135313120 TGTGGTTGCAAATCTCCTGA Chr6:135313034..135313053 60.24 45
upstream ENSMUSE00000689717 Chr6:135317511..135317724 TGCCCTACCTGATCCAAGAG Chr6:135317533..135317552 60.21 55

*** Putative Vector Insertion (Chr 6: 135327195 - 135327307) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000361181 Chr6:135327196..135327306 CCACAAAGAGACCAGCCAGT Chr6:135327262..135327281 60.3 55
downstream ENSMUSE00000717068 Chr6:135327196..135327306 CCACAAAGAGACCAGCCAGT Chr6:135327262..135327281 60.3 55
downstream ENSMUSE00000196383 Chr6:135329919..135330015 TTGCGTAATCTGCAACCATC Chr6:135329946..135329965 59.69 45
downstream ENSMUSE00000314536 Chr6:135330119..135330259 CTGGAACACGAAGACCACAA Chr6:135330201..135330220 59.72 50
downstream ENSMUSE00000334964 Chr6:135330992..135333191 TTGGGGGAATCCTAAAAACC Chr6:135332048..135332067 59.99 45
downstream ENSMUSE00000706743 Chr6:135330992..135333190 TTGGGGGAATCCTAAAAACC Chr6:135332048..135332067 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCCGTCTTTTGTTTTCAGA Chr6:135327178..135327198 60.08 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCCGTCTTTTGTTTTCAGA Chr6:135327178..135327198 60.08 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030208