Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22748
Trapped Gene
2900024C23Rik (ENSMUSG00000029270)
Vector Insertion
Chr 5: 108339236 - 108340630
Public Clones not available
Private Clones OST285695 (lexicon)
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000187533 (Chr5:108340631..108340807 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAACCAGGGGAACTACTGT Chr5:108340668..108340687 58.91 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000187533 (Chr5:108340631..108340807 -)
Downstram Exon
ENSMUSE00000651428 (Chr5:108337357..108339235 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAACCAGGGGAACTACTGT Chr5:108340668..108340687 58.91 55 GGGGTGTCTAGGACGTTTCA Chr5:108337479..108337498 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692520 Chr5:108415968..108416052 GCTGAGGAAACCCCATTACC Chr5:108415973..108415992 60.69 55
upstream ENSMUSE00000387100 Chr5:108353604..108353738 GTCCTACATGCGGGTGAAGT Chr5:108353711..108353730 60 55
upstream ENSMUSE00000187529 Chr5:108343365..108343472 CGGAGTTATTGACGGACCTG Chr5:108343436..108343455 60.51 55
upstream ENSMUSE00000187533 Chr5:108340631..108340807 CCAACCAGGGGAACTACTGT Chr5:108340668..108340687 58.91 55

*** Putative Vector Insertion (Chr 5: 108339236 - 108340630) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000651428 Chr5:108337357..108339235 GGGGTGTCTAGGACGTTTCA Chr5:108337479..108337498 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCGTCCTTACAGAGCGTGA Chr5:108340574..108340594 59.59 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029270