Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22751
Trapped Gene
Snx3 (ENSMUSG00000019804)
Vector Insertion
Chr 10: 42222299 - 42245759
Public Clones IST11559G3 (tigm)
Private Clones OST285654 (lexicon) OST39319 (lexicon) OST28653 (lexicon) OST24307 (lexicon)
OST20304 (lexicon) OST15950 (lexicon) OST13618 (lexicon) OST9693 (lexicon)
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000385950 (Chr10:42222051..42222298 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000385950 (Chr10:42222051..42222298 +)
Downstram Exon
ENSMUSE00000576451 (Chr10:42245760..42245855 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666427 Chr10:42221836..42222232 No primer for this exon
upstream ENSMUSE00000385950 Chr10:42222051..42222298 No primer for this exon
upstream ENSMUSE00000666425 Chr10:42222096..42222298 No primer for this exon

*** Putative Vector Insertion (Chr 10: 42222299 - 42245759) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000576451 Chr10:42245760..42245855 No primer for this exon
downstream ENSMUSE00000098179 Chr10:42252955..42253079 No primer for this exon
downstream ENSMUSE00000342318 Chr10:42254459..42255175 No primer for this exon
downstream ENSMUSE00000666424 Chr10:42254459..42255187 No primer for this exon
downstream ENSMUSE00000666426 Chr10:42254459..42254593 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAACCACTAATCGCCTTGC Chr10:42231342..42231362 60.64 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGACGTGACTGGGAAAACC Chr10:42231346..42231366 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019804