Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22760
Trapped Gene
Serinc4 (ENSMUSG00000046110)
Vector Insertion
Chr 2: 121281510 - 121281578
Public Clones not available
Private Clones OST285379 (lexicon)
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000435759 (Chr2:121281511..121281577 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTGCTATGTGCCCACCTGT Chr2:121281544..121281563 60.6 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000435759 (Chr2:121281511..121281577 -)
Downstram Exon
ENSMUSE00000386149 (Chr2:121281399..121281577 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTGCTATGTGCCCACCTGT Chr2:121281544..121281563 60.6 55 GAGTGGAGGCGAACTAGCAG Chr2:121281410..121281429 60.16 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000714866 Chr2:121282191..121282517 CAGCACGGTGGAGTCAGTAA Chr2:121282216..121282235 59.9 55
upstream ENSMUSE00000719847 Chr2:121282191..121282517 CAGCACGGTGGAGTCAGTAA Chr2:121282216..121282235 59.9 55
upstream ENSMUSE00000339048 Chr2:121281727..121281891 GTAGCCGCCTGCTCTACATC Chr2:121281811..121281830 60.01 60
upstream ENSMUSE00000684597 Chr2:121281727..121281891 GTAGCCGCCTGCTCTACATC Chr2:121281811..121281830 60.01 60
upstream ENSMUSE00000435759 Chr2:121281511..121281577 AGTGCTATGTGCCCACCTGT Chr2:121281544..121281563 60.6 55

*** Putative Vector Insertion (Chr 2: 121281510 - 121281578) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000386149 Chr2:121281399..121281577 GAGTGGAGGCGAACTAGCAG Chr2:121281410..121281429 60.16 60
downstream ENSMUSE00000435748 Chr2:121281399..121281508 GAGTGGAGGCGAACTAGCAG Chr2:121281410..121281429 60.16 60
downstream ENSMUSE00000342523 Chr2:121281012..121281091 AGGCAACGACACAGAGACCT Chr2:121281020..121281039 59.91 55
downstream ENSMUSE00000408619 Chr2:121280680..121280773 ACTGGGCAAAGGCTGTGATA Chr2:121280674..121280693 60.66 50
downstream ENSMUSE00000332053 Chr2:121279734..121279945 ACCCTAGTGTGGCCAGTGAC Chr2:121279862..121279881 60.03 60
downstream ENSMUSE00000435683 Chr2:121279445..121279540 GGCTTGTAGGAGGCCAGAGT Chr2:121279490..121279509 60.79 60
downstream ENSMUSE00000435678 Chr2:121279218..121279344 TCCGGTATTTGTGGTTCCAT Chr2:121279253..121279272 60.05 45
downstream ENSMUSE00000435707 Chr2:121278832..121278904 TAACTCGGCCAGGTAGGAAG Chr2:121278855..121278874 59.33 55
downstream ENSMUSE00000684603 Chr2:121278832..121278904 TAACTCGGCCAGGTAGGAAG Chr2:121278855..121278874 59.33 55
downstream ENSMUSE00000435702 Chr2:121278368..121278416 CATCCTCTGGCTCCACTGTT Chr2:121278346..121278365 60.26 55
downstream ENSMUSE00000684602 Chr2:121278368..121278416 CATCCTCTGGCTCCACTGTT Chr2:121278346..121278365 60.26 55
downstream ENSMUSE00000435696 Chr2:121278091..121278241 AAGCAAGGAAGAAGGCGAAG Chr2:121278106..121278125 61 50
downstream ENSMUSE00000684601 Chr2:121278091..121278241 AAGCAAGGAAGAAGGCGAAG Chr2:121278106..121278125 61 50
downstream ENSMUSE00000336536 Chr2:121276916..121277910 TGGAACCAGAAAGGGTCTTG Chr2:121277427..121277446 60.08 50
downstream ENSMUSE00000641685 Chr2:121276916..121277910 TGGAACCAGAAAGGGTCTTG Chr2:121277427..121277446 60.08 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGATCCAGATGCCCTCAGT Chr2:121281559..121281579 60.22 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGATCCAGATGCCCTCAGT Chr2:121281559..121281579 60.22 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046110