Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22766
Trapped Gene
Atp6v0d1 (ENSMUSG00000013160)
Vector Insertion
Chr 8: 108063393 - 108089682
Public Clones E050F06 (ggtc) CMHD-GT_426H4-3 (cmhd) CMHD-GT_545H2-3 (cmhd) IST12373H12 (tigm)
Private Clones OST285299 (lexicon) OST68988 (lexicon)
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214387 (Chr8:108089683..108089909 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214387 (Chr8:108089683..108089909 -)
Downstram Exon
ENSMUSE00000214380 (Chr8:108063221..108063392 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000214387 Chr8:108089683..108089909 No primer for this exon

*** Putative Vector Insertion (Chr 8: 108063393 - 108089682) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214380 Chr8:108063221..108063392 No primer for this exon
downstream ENSMUSE00000214383 Chr8:108054715..108054893 No primer for this exon
downstream ENSMUSE00000214386 Chr8:108053074..108053153 No primer for this exon
downstream ENSMUSE00000214382 Chr8:108049524..108049601 No primer for this exon
downstream ENSMUSE00000214381 Chr8:108049223..108049399 No primer for this exon
downstream ENSMUSE00000214385 Chr8:108049057..108049134 No primer for this exon
downstream ENSMUSE00000377686 Chr8:108048370..108048964 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTAGCTTTCCTTCCCGTTC Chr8:108068699..108068719 60.2 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTACCTCAACCTGGTGCAGTG Chr8:108077695..108077716 60.75 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCCTGGTACAGGATGCTCTG Chr8:108077906..108077926 60.82 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCCTGGTACAGGATGCTCTG Chr8:108077906..108077926 60.82 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013160