Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22776
Trapped Gene
Nkap (ENSMUSG00000016409)
Vector Insertion
Chr X: 34667371 - 34670972
Public Clones not available
Private Clones OST285144 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000381039 (ChrX:34666811..34667370 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000381039 (ChrX:34666811..34667370 +)
Downstram Exon
ENSMUSE00000509177 (ChrX:34670973..34671053 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000381039 ChrX:34666811..34667370 No primer for this exon

*** Putative Vector Insertion (Chr X: 34667371 - 34670972) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000509177 ChrX:34670973..34671053 No primer for this exon
downstream ENSMUSE00000206203 ChrX:34676507..34676577 No primer for this exon
downstream ENSMUSE00000206205 ChrX:34676747..34676887 No primer for this exon
downstream ENSMUSE00000206201 ChrX:34679672..34679735 No primer for this exon
downstream ENSMUSE00000206199 ChrX:34681633..34681742 No primer for this exon
downstream ENSMUSE00000206198 ChrX:34681832..34681907 No primer for this exon
downstream ENSMUSE00000315669 ChrX:34682900..34683049 No primer for this exon
downstream ENSMUSE00000392663 ChrX:34687786..34690741 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTCTCCGGCAGAAGTGAG ChrX:34670357..34670377 60.13 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGTCTCCGGCAGAAGTGAG ChrX:34670357..34670377 60.13 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000016409