Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22780
Trapped Gene
Ube2l6 (ENSMUSG00000027078)
Vector Insertion
Chr 2: 84646681 - 84649161
Public Clones IST10792D3 (tigm) IST12038D2 (tigm) IST11298C6 (tigm) IST12759B5 (tigm)
IST11959B4 (tigm) IST11677F11 (tigm) IST12038D2 (tigm) IST10750A7 (tigm)
IST10791G1 (tigm) IST12527B2 (tigm) IST12663A5 (tigm) IST10227F10 (tigm)
Private Clones OST285099 (lexicon) OST282790 (lexicon) OST245271 (lexicon)
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000165867 (Chr2:84646494..84646680 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCTACCACCCCAACGTCAG Chr2:84646590..84646609 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000165867 (Chr2:84646494..84646680 +)
Downstram Exon
ENSMUSE00000235664 (Chr2:84649162..84650333 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCTACCACCCCAACGTCAG Chr2:84646590..84646609 59.84 55 GCACAGGCTCTTCCAGATTC Chr2:84649218..84649237 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000389304 Chr2:84638996..84639089 AGTTCAGAGAGCGGTGTCCT Chr2:84639007..84639026 59.05 55
upstream ENSMUSE00000721893 Chr2:84638996..84639089 AGTTCAGAGAGCGGTGTCCT Chr2:84639007..84639026 59.05 55
upstream ENSMUSE00000235673 Chr2:84642936..84643031 CGCCAACTGTCTAGTGACGA Chr2:84642975..84642994 60.05 55
upstream ENSMUSE00000688579 Chr2:84643585..84643677 GGATCTGCCTGTTTGTCCTC Chr2:84643639..84643658 59.66 55
upstream ENSMUSE00000165867 Chr2:84646494..84646680 ATCTACCACCCCAACGTCAG Chr2:84646590..84646609 59.84 55

*** Putative Vector Insertion (Chr 2: 84646681 - 84649161) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000235664 Chr2:84649162..84650333 GCACAGGCTCTTCCAGATTC Chr2:84649218..84649237 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGAGGGGCCGATCTAGAAG Chr2:84646706..84646726 59.81 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGAGGGGCCGATCTAGAAG Chr2:84646706..84646726 59.81 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027078