Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22802
Trapped Gene
Fxyd6 (ENSMUSG00000066705)
Vector Insertion
Chr 9: 45200348 - 45200758
Public Clones not available
Private Clones OST284429 (lexicon)
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000535750 (Chr9:45200298..45200347 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGGTGGAGAACCTCATCA Chr9:45200319..45200338 61.07 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000535750 (Chr9:45200298..45200347 +)
Downstram Exon
ENSMUSE00000535749 (Chr9:45200759..45200808 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGGTGGAGAACCTCATCA Chr9:45200319..45200338 61.07 55 AGGCTGCACCTCAGTTCTCT Chr9:45200800..45200819 59.21 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000535767 Chr9:45178522..45178571 No primer for this exon
upstream ENSMUSE00000535764 Chr9:45198071..45198130 No primer for this exon
upstream ENSMUSE00000535762 Chr9:45198717..45198755 No primer for this exon
upstream ENSMUSE00000535757 Chr9:45198860..45198934 TCCTCTTCTCCGTTGGGATA Chr9:45198902..45198921 59.62 50
upstream ENSMUSE00000535752 Chr9:45199644..45199680 No primer for this exon
upstream ENSMUSE00000535750 Chr9:45200298..45200347 CCAGGTGGAGAACCTCATCA Chr9:45200319..45200338 61.07 55

*** Putative Vector Insertion (Chr 9: 45200348 - 45200758) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000535749 Chr9:45200759..45200808 AGGCTGCACCTCAGTTCTCT Chr9:45200800..45200819 59.21 55
downstream ENSMUSE00000535748 Chr9:45203066..45204237 TCCAAGGGAACACATTAGGC Chr9:45204141..45204160 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACGGTAACCGCTGTGAAAG Chr9:45200345..45200365 60.17 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACGGTAACCGCTGTGAAAG Chr9:45200345..45200365 60.17 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066705