Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22807
Trapped Gene
Dmd (ENSMUSG00000045103)
Vector Insertion
Chr X: 82293799 - 82299309
Public Clones not available
Private Clones OST284316 (lexicon) OST168668 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697656 (ChrX:82293752..82293798 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCTGTGAAACCCTTACAA ChrX:82293757..82293776 59.17 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697656 (ChrX:82293752..82293798 +)
Downstram Exon
ENSMUSE00000303684 (ChrX:82299310..82299371 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCTGTGAAACCCTTACAA ChrX:82293757..82293776 59.17 45 ACAAGTGGTTTGGGTCTCGT ChrX:82299334..82299353 59.47 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697740 ChrX:80194242..80194486 TTGCCCCTTACAGGACTCAG ChrX:80194251..80194270 60.25 55
upstream ENSMUSE00000550618 ChrX:80381967..80382028 TCACAAAATGGATAAATGCACA ChrX:80381997..80382018 58.94 31.82
upstream ENSMUSE00000304148 ChrX:80591601..80591693 GGAAAACGCCTCCTAGACCT ChrX:80591646..80591665 59.71 55
upstream ENSMUSE00000304146 ChrX:80596765..80596842 CACTGCGGGTCTTACAGAAA ChrX:80596817..80596836 58.92 50
upstream ENSMUSE00000550616 ChrX:80620398..80620490 No primer for this exon
upstream ENSMUSE00000697668 ChrX:80620398..80620454 No primer for this exon
upstream ENSMUSE00000463420 ChrX:80626524..80626696 ATTGCAGCAAACCAACAGTG ChrX:80626556..80626575 59.76 45
upstream ENSMUSE00000460512 ChrX:80735166..80735284 CACTCAGCCACCCAAAGACT ChrX:80735203..80735222 60.3 55
upstream ENSMUSE00000697667 ChrX:80872600..80872785 TTTTGCCACAACAAGTGAGC ChrX:80872664..80872683 59.89 45
upstream ENSMUSE00000304130 ChrX:80872601..80872785 TTTTGCCACAACAAGTGAGC ChrX:80872664..80872683 59.89 45
upstream ENSMUSE00000304124 ChrX:80873906..80874037 CAGAGCCCCTATCCTTCACA ChrX:80874017..80874036 60.21 55
upstream ENSMUSE00000304118 ChrX:80909387..80909575 TACATTGCGAGCACAAGGAG ChrX:80909506..80909525 60.01 50
upstream ENSMUSE00000420937 ChrX:80910387..80910568 TGGGAATGTCTCAGGGTAGC ChrX:80910528..80910547 60.07 55
upstream ENSMUSE00000420934 ChrX:80923618..80923768 CCCTTTGGACCTGATCTTGA ChrX:80923718..80923737 60.04 50
upstream ENSMUSE00000420930 ChrX:80937107..80937226 GGTCAACTCGCTCACTCACA ChrX:80937142..80937161 60.03 55
upstream ENSMUSE00000304096 ChrX:80959442..80959543 CTGAAGACCGCTGGATTGTT ChrX:80959479..80959498 60.26 50
upstream ENSMUSE00000147703 ChrX:80959639..80959746 TGCAATGAAGAACATTCAGACA ChrX:80959674..80959695 59.32 36.36
upstream ENSMUSE00000147701 ChrX:80967207..80967386 AAAAGCCAACCATGGAAAAA ChrX:80967232..80967251 59.43 35
upstream ENSMUSE00000147716 ChrX:80974660..80974835 AAGAGGAACTTCCACCACCA ChrX:80974766..80974785 59.55 50
upstream ENSMUSE00000420912 ChrX:81000716..81000839 CGAAAAGAAGGCAACATCTCA ChrX:81000798..81000818 60.37 42.86
upstream ENSMUSE00000420943 ChrX:81017874..81017961 GCCATAGCACGAGAAAAAGC ChrX:81017874..81017893 59.99 50
upstream ENSMUSE00000420910 ChrX:81026868..81027109 TGCCAATTGCTGAGTGAGAG ChrX:81026933..81026952 60.14 50
upstream ENSMUSE00000420907 ChrX:81031474..81031654 GTGTGAGGGCCAAAGAGAAA ChrX:81031622..81031641 60.23 50
upstream ENSMUSE00000147695 ChrX:81047586..81047731 TTACCACCAATGCGCTATCA ChrX:81047597..81047616 60.1 45
upstream ENSMUSE00000147700 ChrX:81048645..81048857 GAAGAGATTGAGGGGCACTG ChrX:81048762..81048781 59.8 55
upstream ENSMUSE00000147712 ChrX:81051465..81051578 TGGATGGCTGAAGTTGATGT ChrX:81051489..81051508 59.09 45
upstream ENSMUSE00000147708 ChrX:81052675..81052830 TGTTAATGAAGGTGGGCAGA ChrX:81052719..81052738 59.12 45
upstream ENSMUSE00000147693 ChrX:81058814..81058984 AAAACCGTAAGCCTCCAAAAA ChrX:81058853..81058873 59.99 38.1
upstream ENSMUSE00000420887 ChrX:81063471..81063653 ACCAGGCTGAATGGAAAATG ChrX:81063621..81063640 59.93 45
upstream ENSMUSE00000147711 ChrX:81073294..81073428 GAAAGCAAACAAGTGGCTCA ChrX:81073335..81073354 59.05 45
upstream ENSMUSE00000147684 ChrX:81075759..81075908 TTCTCGTTGGAGGGAACTACA ChrX:81075881..81075901 59.72 47.62
upstream ENSMUSE00000697661 ChrX:81100746..81100935 GCTCGAAAGCTACGCAATCT ChrX:81100903..81100922 59.76 50
upstream ENSMUSE00000420879 ChrX:81101045..81101206 AAGGTGGATGCAGCTCAAAT ChrX:81101171..81101190 59.7 45
upstream ENSMUSE00000481398 ChrX:81123386..81123496 CCAACCAAAGGGTTCTTTCA ChrX:81123459..81123478 59.94 45
upstream ENSMUSE00000482384 ChrX:81123815..81123988 TTCCAAAAACCAGCCAATTT ChrX:81123851..81123870 59.43 35
upstream ENSMUSE00000475896 ChrX:81126618..81126773 TGATTAAAACCGGACGTCAA ChrX:81126664..81126683 59.01 40
upstream ENSMUSE00000476701 ChrX:81132402..81132572 TGCTTGAAGTTGTCCCGTAA ChrX:81132432..81132451 59.32 45
upstream ENSMUSE00000697660 ChrX:81132402..81132476 TGCTTGAAGTTGTCCCGTAA ChrX:81132432..81132451 59.32 45
upstream ENSMUSE00000477886 ChrX:81150287..81150466 TGTTGGGCAAGAAAGAAACC ChrX:81150363..81150382 60.09 45
upstream ENSMUSE00000478694 ChrX:81151328..81151456 CAAAGTGGATCATTCATGCAG ChrX:81151377..81151397 59.14 42.86
upstream ENSMUSE00000503921 ChrX:81153720..81153890 CCGTCGATTTGCAGCTATTT ChrX:81153848..81153867 60.23 45
upstream ENSMUSE00000493132 ChrX:81167806..81167928 ATTCAGCAGGGGGTGAATCT ChrX:81167881..81167900 60.85 50
upstream ENSMUSE00000505962 ChrX:81170191..81170328 No primer for this exon
upstream ENSMUSE00000502907 ChrX:81173184..81173336 CAGCCTACCTGAACCCAGAG ChrX:81173300..81173319 59.86 60
upstream ENSMUSE00000500339 ChrX:81174142..81174324 GCAGTGGAGCCAACTCAGAT ChrX:81174232..81174251 60.42 55
upstream ENSMUSE00000504919 ChrX:81200302..81200496 ACGACTGAAGATATGCCTTTGG ChrX:81200332..81200353 60.5 45.46
upstream ENSMUSE00000502416 ChrX:81210008..81210180 CCTCCATGGAAAAGGTGAAA ChrX:81210090..81210109 59.9 45
upstream ENSMUSE00000499333 ChrX:81267604..81267751 CAGTTGAAAAATGGCGACAC ChrX:81267618..81267637 59.17 45
upstream ENSMUSE00000495780 ChrX:81517291..81517466 ACTGAATGCAACTGGGGAAG ChrX:81517335..81517354 60.11 50
upstream ENSMUSE00000517700 ChrX:81555138..81555279 GTTTTGTGGCTGGAAGAAGC ChrX:81555193..81555212 59.86 50
upstream ENSMUSE00000550588 ChrX:81557816..81557965 GCGCCAGGGAATTCTAAAAC ChrX:81557839..81557858 60.93 50
upstream ENSMUSE00000497360 ChrX:81618722..81618886 AGGCAGGACCGTTTGACATA ChrX:81618864..81618883 60.52 50
upstream ENSMUSE00000493823 ChrX:81671047..81671148 AAACAAGCGGATGTGGAAAG ChrX:81671071..81671090 60.11 45
upstream ENSMUSE00000508192 ChrX:81677223..81677331 CCATTTACTTCGGGAGCTGA ChrX:81677264..81677283 60.21 50
upstream ENSMUSE00000509205 ChrX:81719473..81719705 GACTTCAACCGAGCTTGGAC ChrX:81719583..81719602 59.85 55
upstream ENSMUSE00000517903 ChrX:81777213..81777330 GCTGCCCAGAATTTGAAAAA ChrX:81777267..81777286 60.19 40
upstream ENSMUSE00000519874 ChrX:81820899..81821110 GAAGCCGAACAGGTCATAGG ChrX:81821009..81821028 59.69 55
upstream ENSMUSE00000514362 ChrX:81844435..81844589 TCCGTCAACGGCAGATAAGT ChrX:81844451..81844470 60.66 50
upstream ENSMUSE00000515366 ChrX:81892376..81892565 CCTGGATTACGGAAGCAGAA ChrX:81892456..81892475 60.21 50
upstream ENSMUSE00000654811 ChrX:82018050..82018245 CCGGTTCAAGCTGAAAATGT ChrX:82018200..82018219 60.11 45
upstream ENSMUSE00000475256 ChrX:82018921..82019093 GCACCCCTGTTACAAAGACG ChrX:82019017..82019036 60.55 55
upstream ENSMUSE00000472426 ChrX:82027258..82027414 GTGGAAGCGTTTGCATCTTT ChrX:82027285..82027304 60.26 45
upstream ENSMUSE00000469376 ChrX:82062637..82062757 GCCTTCAAGAGGGAATTGAA ChrX:82062637..82062656 59.24 45
upstream ENSMUSE00000474229 ChrX:82063366..82063634 AATGTCACTCGGCTCCTACG ChrX:82063392..82063411 60.28 55
upstream ENSMUSE00000471641 ChrX:82093987..82094133 ACATCAGCTGACCACACTGG ChrX:82094046..82094065 59.74 55
upstream ENSMUSE00000468801 ChrX:82189484..82189562 No primer for this exon
upstream ENSMUSE00000511910 ChrX:82220044..82220104 TCACCAAACAAAGTGCCCTAC ChrX:82220076..82220096 60.02 47.62
upstream ENSMUSE00000706981 ChrX:82220044..82221046 GTTTTGGAGGGTGAGCAGAA ChrX:82220301..82220320 60.23 50
upstream ENSMUSE00000697656 ChrX:82293752..82293798 TGCCTGTGAAACCCTTACAA ChrX:82293757..82293776 59.17 45
upstream ENSMUSE00000717676 ChrX:82293752..82293798 TGCCTGTGAAACCCTTACAA ChrX:82293757..82293776 59.17 45

*** Putative Vector Insertion (Chr X: 82293799 - 82299309) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000303684 ChrX:82299310..82299371 ACAAGTGGTTTGGGTCTCGT ChrX:82299334..82299353 59.47 50
downstream ENSMUSE00000303678 ChrX:82335156..82335230 CGCGGAGAACCTGACATTAT ChrX:82335187..82335206 60.1 50
downstream ENSMUSE00000147657 ChrX:82350483..82350684 TTGTTGTGCTCTTGCTCCAG ChrX:82350624..82350643 60.17 50
downstream ENSMUSE00000147670 ChrX:82352919..82353004 No primer for this exon
downstream ENSMUSE00000147675 ChrX:82355282..82355439 TTGAACTTGCCACTTGCTTG ChrX:82355311..82355330 60.03 45
downstream ENSMUSE00000381257 ChrX:82384667..82384833 CTTGATGCTTGGCAGTTTCA ChrX:82384793..82384812 59.99 45
downstream ENSMUSE00000147673 ChrX:82387065..82387176 TTTTATGGCCCTTTGCAACT ChrX:82387147..82387166 59.59 40
downstream ENSMUSE00000147668 ChrX:82389368..82389504 TTCCATGTTGTCCCCCTCTA ChrX:82389505..82389524 60.31 50
downstream ENSMUSE00000462409 ChrX:82390250..82390288 CTGGCCAGAAGTTGATCAGAG ChrX:82390280..82390300 60 52.38
downstream ENSMUSE00000147666 ChrX:82394469..82394534 TGCGTGAATGAGTATCATCG ChrX:82394518..82394537 58.23 45
downstream ENSMUSE00000147664 ChrX:82395552..82395617 TTGCTGTTTTCCATTTCTGC ChrX:82395578..82395597 58.9 40
downstream ENSMUSE00000147676 ChrX:82398366..82398524 GGGGAGTCCTGGTTCAAACT ChrX:82398425..82398444 60.35 55
downstream ENSMUSE00000147661 ChrX:82423043..82423286 AGAGGTGGGCATCATCTCAG ChrX:82423139..82423158 60.22 55
downstream ENSMUSE00000147659 ChrX:82424038..82424161 AACCACTCGGAGCAGCATAG ChrX:82424139..82424158 60.42 55
downstream ENSMUSE00000147655 ChrX:82435949..82436041 AGGAGTTGTTGAGTTGCTCCA ChrX:82436028..82436048 59.9 47.62
downstream ENSMUSE00000465159 ChrX:82442843..82442874 No primer for this exon
downstream ENSMUSE00000706982 ChrX:82442843..82442883 No primer for this exon
downstream ENSMUSE00000697655 ChrX:82447810..82450378 GTTTGGAGACGCTTTTGCTC ChrX:82449383..82449402 60 50
downstream ENSMUSE00000697670 ChrX:82447810..82451480 GTTTGGAGACGCTTTTGCTC ChrX:82449383..82449402 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTGAAAGGGAAAGGGAAAG ChrX:82296792..82296813 61.38 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCTTGAAAGGGAAAGGGAAAG ChrX:82296792..82296813 61.38 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045103