Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22813
Trapped Gene
Prepl (ENSMUSG00000024127)
Vector Insertion
Chr 17: 85477965 - 85480403
Public Clones not available
Private Clones OST284163 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000138575 (Chr17:85480404..85480610 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGTAATGGAAGCGTCGTT Chr17:85480424..85480443 60.13 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000138575 (Chr17:85480404..85480610 -)
Downstram Exon
ENSMUSE00000138580 (Chr17:85477829..85477964 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGTAATGGAAGCGTCGTT Chr17:85480424..85480443 60.13 50 TGTGGCTCGATACACATCGT Chr17:85477857..85477876 60.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000444096 Chr17:85489446..85489548 CTCTACCTTCGCTCGTCCAG Chr17:85489462..85489481 60.15 60
upstream ENSMUSE00000606009 Chr17:85487680..85487779 ATCCCAAGTCGGAGCTTCTC Chr17:85487687..85487706 60.74 55
upstream ENSMUSE00000691103 Chr17:85487680..85487892 CAGACGGCCAAATTCTCTCT Chr17:85487867..85487886 59.43 50
upstream ENSMUSE00000606010 Chr17:85482533..85482655 GACTGGAAACACAGCCACAG Chr17:85482560..85482579 59.31 55
upstream ENSMUSE00000691101 Chr17:85482533..85482655 GACTGGAAACACAGCCACAG Chr17:85482560..85482579 59.31 55
upstream ENSMUSE00000138569 Chr17:85481312..85481378 GCTTGGTTCGTTCCAAAGAC Chr17:85481319..85481338 59.72 50
upstream ENSMUSE00000138575 Chr17:85480404..85480610 CCTGTAATGGAAGCGTCGTT Chr17:85480424..85480443 60.13 50

*** Putative Vector Insertion (Chr 17: 85477965 - 85480403) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000138580 Chr17:85477829..85477964 TGTGGCTCGATACACATCGT Chr17:85477857..85477876 60.14 50
downstream ENSMUSE00000138577 Chr17:85475949..85476165 CCTCGGAAGTCGTCTTGTTC Chr17:85476067..85476086 59.84 55
downstream ENSMUSE00000138576 Chr17:85475206..85475391 TTTAGGGAGCGCACTGAGTC Chr17:85475185..85475204 60.54 55
downstream ENSMUSE00000138564 Chr17:85471252..85471449 AATCGGATCTTCGTGACCAG Chr17:85471272..85471291 60.07 50
downstream ENSMUSE00000138574 Chr17:85469768..85469943 TCCATAGACGTGCACCAAGA Chr17:85469835..85469854 60.26 50
downstream ENSMUSE00000138571 Chr17:85468225..85468441 TTACACAGTGCTCCCACGAG Chr17:85468240..85468259 59.9 55
downstream ENSMUSE00000138567 Chr17:85465488..85465637 GCAGGGACAGTAGCGCTTTA Chr17:85465484..85465503 60.54 55
downstream ENSMUSE00000138582 Chr17:85464972..85465095 CGCTCATCGTTTTCATAGGC Chr17:85465030..85465049 60.74 50
downstream ENSMUSE00000138565 Chr17:85464382..85464455 CCCCAGGCTGAATATCTAGG Chr17:85464392..85464411 58.62 55
downstream ENSMUSE00000444047 Chr17:85462826..85464073 TGCTGGTGGGAACAGTATGA Chr17:85463796..85463815 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTAGAAAGGCAGCCAAGG Chr17:85480365..85480385 60.01 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTAGAAAGGCAGCCAAGG Chr17:85480365..85480385 60.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024127