Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22816
Trapped Gene
Ddx59 (ENSMUSG00000026404)
Vector Insertion
Chr 1: 138321462 - 138328888
Public Clones IST12432F6 (tigm) IST12432F6 (tigm) IST10918B12 (tigm) IST11877F2 (tigm)
Private Clones OST284025 (lexicon) OST142494 (lexicon) OST65790 (lexicon) OST60434 (lexicon)
OST10122 (lexicon)
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000234138 (Chr1:138321372..138321461 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATAGCAACCCCTGGACGACT Chr1:138321378..138321397 60.9 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000234138 (Chr1:138321372..138321461 +)
Downstram Exon
ENSMUSE00000234131 (Chr1:138328889..138329140 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATAGCAACCCCTGGACGACT Chr1:138321378..138321397 60.9 55 TGTGTTCCAAAACGTCAAGC Chr1:138328949..138328968 59.74 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000234159 Chr1:138311848..138312000 No primer for this exon
upstream ENSMUSE00000234151 Chr1:138313159..138313973 ACCCTCAAGGAGGACCAGAT Chr1:138313695..138313714 59.93 55
upstream ENSMUSE00000158758 Chr1:138315987..138316154 TTCTCGTAGGGGGCTTACCT Chr1:138316096..138316115 60.09 55
upstream ENSMUSE00000234138 Chr1:138321372..138321461 ATAGCAACCCCTGGACGACT Chr1:138321378..138321397 60.9 55

*** Putative Vector Insertion (Chr 1: 138321462 - 138328888) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000234131 Chr1:138328889..138329140 TGTGTTCCAAAACGTCAAGC Chr1:138328949..138328968 59.74 45
downstream ENSMUSE00000234123 Chr1:138330290..138330442 ATCTGCGCCTAGTTTGCAGT Chr1:138330352..138330371 60.04 50
downstream ENSMUSE00000234115 Chr1:138331083..138331211 TGCTCACCACGACCTCATAG Chr1:138331122..138331141 59.85 55
downstream ENSMUSE00000234109 Chr1:138336330..138336728 TCCATTTTGACCGAGTCTCC Chr1:138336365..138336384 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGGACGTTGGCTGTAATC Chr1:138321498..138321518 60.38 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGTATCACTCAGTGGCATAAA Chr1:138321422..138321444 60.02 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026404