Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22830
Trapped Gene
Lsg1 (ENSMUSG00000022538)
Vector Insertion
Chr 16: 30582229 - 30582616
Public Clones not available
Private Clones OST283666 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000128049 (Chr16:30582617..30582737 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGAGGCTAGAACCGGACTG Chr16:30582691..30582710 60.01 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000128049 (Chr16:30582617..30582737 -)
Downstram Exon
ENSMUSE00000128039 (Chr16:30582142..30582228 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGAGGCTAGAACCGGACTG Chr16:30582691..30582710 60.01 60 CGCCTCCATTTCAGGAAGTT Chr16:30582132..30582151 61.5 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000231390 Chr16:30587524..30587649 CTGTTGATGCGTGGTTATGG Chr16:30587619..30587638 59.99 50
upstream ENSMUSE00000708461 Chr16:30587524..30587678 CTGTTGATGCGTGGTTATGG Chr16:30587619..30587638 59.99 50
upstream ENSMUSE00000231380 Chr16:30585640..30585766 ATGACTGGGGTCGTCTGAAT Chr16:30585719..30585738 59.38 50
upstream ENSMUSE00000128049 Chr16:30582617..30582737 CTGAGGCTAGAACCGGACTG Chr16:30582691..30582710 60.01 60

*** Putative Vector Insertion (Chr 16: 30582229 - 30582616) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000128039 Chr16:30582142..30582228 CGCCTCCATTTCAGGAAGTT Chr16:30582132..30582151 61.5 50
downstream ENSMUSE00000128040 Chr16:30581045..30581131 GTTCCGTTCAAAGGGAGTCA Chr16:30581064..30581083 60.09 50
downstream ENSMUSE00000128032 Chr16:30574632..30574692 TCGAGCATCTACGATCTGGAC Chr16:30574640..30574660 60.38 52.38
downstream ENSMUSE00000231342 Chr16:30573279..30573455 CTTGGCAGCATCGATCTCTT Chr16:30573401..30573420 60.5 50
downstream ENSMUSE00000231331 Chr16:30571251..30571622 ACTGTCACTTGCGGACTCCT Chr16:30571478..30571497 59.91 55
downstream ENSMUSE00000128043 Chr16:30569415..30569516 No primer for this exon
downstream ENSMUSE00000711017 Chr16:30569200..30569334 CATCTGGTCGATAGGGAGGA Chr16:30569196..30569215 60.03 55
downstream ENSMUSE00000128042 Chr16:30569191..30569334 CATCTGGTCGATAGGGAGGA Chr16:30569196..30569215 60.03 55
downstream ENSMUSE00000708195 Chr16:30568979..30568982 No primer for this exon
downstream ENSMUSE00000128037 Chr16:30567797..30567920 AGGTCGGTAGGGGTCTTCAT Chr16:30567809..30567828 59.82 55
downstream ENSMUSE00000717779 Chr16:30567797..30567925 AGGTCGGTAGGGGTCTTCAT Chr16:30567809..30567828 59.82 55
downstream ENSMUSE00000231304 Chr16:30565516..30565595 GATGTACCGTGCAGATCGAG Chr16:30565512..30565531 59.27 55
downstream ENSMUSE00000231298 Chr16:30564732..30564905 CCGGCTGAAGTCTCAGTTCT Chr16:30564769..30564788 59.6 55
downstream ENSMUSE00000702158 Chr16:30561459..30561948 CCTGGACACCTTTGGTCAGT Chr16:30561893..30561912 60 55
downstream ENSMUSE00000716429 Chr16:30560580..30561948 CCATTCTCGTTCAACCACCT Chr16:30561077..30561096 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGCTGGATTAATCGCCTTG Chr16:30582554..30582574 61.45 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAATGAGGCTGGATCGTGAC Chr16:30582559..30582579 60.63 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022538