Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22852
Trapped Gene
Ankrd6 (ENSMUSG00000040183)
Vector Insertion
Chr 4: 32923409 - 32947296
Public Clones not available
Private Clones OST282903 (lexicon) OST266559 (lexicon) OST56148 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000675830 (Chr4:32947297..32947417 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGCTCATAGCTGCGTACA Chr4:32947359..32947378 60.18 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000675830 (Chr4:32947297..32947417 -)
Downstram Exon
ENSMUSE00000235918 (Chr4:32923310..32923408 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGCTCATAGCTGCGTACA Chr4:32947359..32947378 60.18 55 CAGCAAAATCTGCACCACAG Chr4:32923321..32923340 60.45 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000528126 Chr4:33037722..33037801 No primer for this exon
upstream ENSMUSE00000675831 Chr4:33037722..33037816 No primer for this exon
upstream ENSMUSE00000500655 Chr4:33010276..33010480 TCTGAGACTGGACGGAAGGT Chr4:33010372..33010391 59.83 55
upstream ENSMUSE00000528122 Chr4:33010272..33010480 TCTGAGACTGGACGGAAGGT Chr4:33010372..33010391 59.83 55
upstream ENSMUSE00000495723 Chr4:32961182..32961345 TTATTCTGGAGAGCGGCCTA Chr4:32961230..32961249 59.94 50
upstream ENSMUSE00000235928 Chr4:32947297..32947563 CCTGCTCATAGCTGCGTACA Chr4:32947359..32947378 60.18 55
upstream ENSMUSE00000675830 Chr4:32947297..32947417 CCTGCTCATAGCTGCGTACA Chr4:32947359..32947378 60.18 55
upstream ENSMUSE00000710696 Chr4:32947297..32947563 CCTGCTCATAGCTGCGTACA Chr4:32947359..32947378 60.18 55

*** Putative Vector Insertion (Chr 4: 32923409 - 32947296) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000235918 Chr4:32923310..32923408 CAGCAAAATCTGCACCACAG Chr4:32923321..32923340 60.45 50
downstream ENSMUSE00000235909 Chr4:32915685..32915783 GCTGTGAGGATCTCGGTGTT Chr4:32915703..32915722 60.27 55
downstream ENSMUSE00000235903 Chr4:32914064..32914162 TGTTTCTGGCAAGCACATTG Chr4:32914044..32914063 60.84 45
downstream ENSMUSE00000235898 Chr4:32911371..32911469 No primer for this exon
downstream ENSMUSE00000235889 Chr4:32910381..32910479 TGACGACGGACAAGTGGTTA Chr4:32910403..32910422 60.15 50
downstream ENSMUSE00000235882 Chr4:32909128..32909226 TCACAATGGTTGTGTCAGCA Chr4:32909111..32909130 59.71 45
downstream ENSMUSE00000235875 Chr4:32908232..32908309 TTATTGTGGTAGCGGGCAGT Chr4:32908247..32908266 60.52 50
downstream ENSMUSE00000235869 Chr4:32905580..32905684 CCCTCCTCTCTTCCTTGAGC Chr4:32905596..32905615 60.47 60
downstream ENSMUSE00000235864 Chr4:32904394..32904525 GGAAGCTGGTGGACAATCTC Chr4:32904417..32904436 59.66 55
downstream ENSMUSE00000235854 Chr4:32903886..32904071 CTTTTGGTGTCCAGGCTGTT Chr4:32903993..32904012 60.15 50
downstream ENSMUSE00000235848 Chr4:32902210..32902362 TATCCTGCACCGAGCCTAAC Chr4:32902235..32902254 60.24 55
downstream ENSMUSE00000235840 Chr4:32897173..32897286 TTCCACCATCAGTTTGTCCA Chr4:32897235..32897254 59.94 45
downstream ENSMUSE00000235830 Chr4:32895659..32895785 GAGTCAGACGGAGGTGGTGT Chr4:32895645..32895664 60.16 60
downstream ENSMUSE00000675832 Chr4:32893088..32893602 CTTATCCTTGGGCCTCACAA Chr4:32893516..32893535 60.07 50
downstream ENSMUSE00000675829 Chr4:32892715..32893602 TCACTGAATCGCAGACTTGG Chr4:32892817..32892836 59.98 50
downstream ENSMUSE00000361839 Chr4:32891010..32893617 TCACTGAATCGCAGACTTGG Chr4:32892817..32892836 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTCCTTATTCTCCGGATT Chr4:32944244..32944264 59.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCCTTATTCTCCGGATCG Chr4:32944243..32944263 60.91 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040183