Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22853
Trapped Gene
Pawr (ENSMUSG00000035873)
Vector Insertion
Chr 10: 107846667 - 107849019
Public Clones not available
Private Clones OST282889 (lexicon)
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000256438 (Chr10:107846519..107846666 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGGCTAGTTTCTCCTCAAGT Chr10:107846610..107846630 59.89 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000256438 (Chr10:107846519..107846666 +)
Downstram Exon
ENSMUSE00000256431 (Chr10:107849020..107849124 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGGCTAGTTTCTCCTCAAGT Chr10:107846610..107846630 59.89 52.38 CAGCCTCACAAGTCGAAGGT Chr10:107849067..107849086 60.44 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000640527 Chr10:107769245..107769304 CTCACCTGGACAACCCTCAT Chr10:107769245..107769264 59.96 55
upstream ENSMUSE00000607844 Chr10:107769744..107770367 GCAGATCGAGAAGAGGAAGC Chr10:107770298..107770317 59.27 55
upstream ENSMUSE00000256455 Chr10:107819786..107819917 CAGGACAGAAGGAACGGAAG Chr10:107819814..107819833 59.84 55
upstream ENSMUSE00000256447 Chr10:107828754..107828788 CGAGAACAGTTCCAGGCAGA Chr10:107828761..107828780 61.53 55
upstream ENSMUSE00000256438 Chr10:107846519..107846666 CCGGCTAGTTTCTCCTCAAGT Chr10:107846610..107846630 59.89 52.38

*** Putative Vector Insertion (Chr 10: 107846667 - 107849019) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000256431 Chr10:107849020..107849124 CAGCCTCACAAGTCGAAGGT Chr10:107849067..107849086 60.44 55
downstream ENSMUSE00000607842 Chr10:107850724..107851447 CCTCTCAACAACGCAGTGAA Chr10:107850920..107850939 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATTCTTTAATCGCCTTGCAG Chr10:107846711..107846732 59.86 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTCAAGTAGCACCTTGGAAA Chr10:107846624..107846645 59.36 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035873