Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22859
Trapped Gene
Ddx18 (ENSMUSG00000001674)
Vector Insertion
Chr 1: 123462746 - 123464367
Public Clones not available
Private Clones OST282792 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000337241 (Chr1:123464368..123464480 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000337241 (Chr1:123464368..123464480 -)
Downstram Exon
ENSMUSE00000222696 (Chr1:123462458..123462745 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000337241 Chr1:123464368..123464480 No primer for this exon

*** Putative Vector Insertion (Chr 1: 123462746 - 123464367) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000222696 Chr1:123462458..123462745 No primer for this exon
downstream ENSMUSE00000222688 Chr1:123461070..123461180 No primer for this exon
downstream ENSMUSE00000222681 Chr1:123458636..123458771 No primer for this exon
downstream ENSMUSE00000492125 Chr1:123458267..123458367 No primer for this exon
downstream ENSMUSE00000158195 Chr1:123457858..123458172 No primer for this exon
downstream ENSMUSE00000158196 Chr1:123456709..123456848 No primer for this exon
downstream ENSMUSE00000158194 Chr1:123455743..123455904 No primer for this exon
downstream ENSMUSE00000158199 Chr1:123454988..123455140 No primer for this exon
downstream ENSMUSE00000222648 Chr1:123453982..123454095 No primer for this exon
downstream ENSMUSE00000222640 Chr1:123452268..123452324 No primer for this exon
downstream ENSMUSE00000498442 Chr1:123451793..123451970 No primer for this exon
downstream ENSMUSE00000383177 Chr1:123450419..123450715 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGGGAACCCAGGAATAAT Chr1:123464312..123464332 59.88 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGAACGTGACTGGGAAAAC Chr1:123464301..123464321 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001674