Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22868
Trapped Gene
Oxr1 (ENSMUSG00000022307)
Vector Insertion
Chr 15: 41279136 - 41367115
Public Clones (ggtc) (ggtc) IST12686C8 (tigm) IST11925F6 (tigm)
Private Clones OST282583 (lexicon) OST194490 (lexicon) OST112180 (lexicon) OST100465 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683442 (Chr15:41279047..41279135 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683442 (Chr15:41279047..41279135 +)
Downstram Exon
ENSMUSE00000624065 (Chr15:41367116..41367273 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGGAACAGGCAGAACCACTT Chr15:41367161..41367180 60.69 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683442 Chr15:41279047..41279135 No primer for this exon

*** Putative Vector Insertion (Chr 15: 41279136 - 41367115) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000624065 Chr15:41367116..41367273 TGGAACAGGCAGAACCACTT Chr15:41367161..41367180 60.69 50
downstream ENSMUSE00000624064 Chr15:41485011..41485207 GGTTGAACCCTGGAGCAGTA Chr15:41485063..41485082 60.11 55
downstream ENSMUSE00000350104 Chr15:41621069..41621164 AAGCGCTTCCGATTACAAAG Chr15:41621148..41621167 59.5 45
downstream ENSMUSE00000683455 Chr15:41628977..41628991 No primer for this exon
downstream ENSMUSE00000683441 Chr15:41629020..41629102 AGGTCTTCTTTTGGCCAGTG Chr15:41629043..41629062 59.33 50
downstream ENSMUSE00000649491 Chr15:41629022..41629102 No primer for this exon
downstream ENSMUSE00000624062 Chr15:41632017..41632124 TCACGACTGCTCGAGAGAAT Chr15:41632119..41632138 58.7 50
downstream ENSMUSE00000624061 Chr15:41633128..41633241 AGGGATGGGGAACTCTCAAC Chr15:41633186..41633205 60.31 55
downstream ENSMUSE00000624060 Chr15:41645120..41645272 TTTGGATGGGCTACATCTGG Chr15:41645145..41645164 60.85 50
downstream ENSMUSE00000624059 Chr15:41648628..41648812 TGATGCCGTATTCCTCACAA Chr15:41648736..41648755 60.07 45
downstream ENSMUSE00000711367 Chr15:41651385..41652124 GAGCTAGTGCGGTCAGGAAC Chr15:41651711..41651730 60.02 60
downstream ENSMUSE00000722306 Chr15:41651385..41652124 GAGCTAGTGCGGTCAGGAAC Chr15:41651711..41651730 60.02 60
downstream ENSMUSE00000649489 Chr15:41654873..41655041 TAATCGATGCCTTCGCTTTT Chr15:41654913..41654932 59.82 40
downstream ENSMUSE00000649505 Chr15:41654873..41655041 TAATCGATGCCTTCGCTTTT Chr15:41654913..41654932 59.82 40
downstream ENSMUSE00000649488 Chr15:41657436..41657598 CGCTTCAGACTCGTCCATCT Chr15:41657559..41657578 60.56 55
downstream ENSMUSE00000649530 Chr15:41657436..41657598 CGCTTCAGACTCGTCCATCT Chr15:41657559..41657578 60.56 55
downstream ENSMUSE00000125412 Chr15:41680216..41680296 AGAGTGTGCGCAGTTCTTCA Chr15:41680285..41680304 59.78 50
downstream ENSMUSE00000683447 Chr15:41680216..41680296 AGAGTGTGCGCAGTTCTTCA Chr15:41680285..41680304 59.78 50
downstream ENSMUSE00000649485 Chr15:41682005..41682130 TTTGGTCGGAAAGATTCAGG Chr15:41682087..41682106 60.04 45
downstream ENSMUSE00000649528 Chr15:41682005..41682130 TTTGGTCGGAAAGATTCAGG Chr15:41682087..41682106 60.04 45
downstream ENSMUSE00000649483 Chr15:41682921..41683073 CCATGGATAGCCAATGGTTC Chr15:41682965..41682984 60.15 50
downstream ENSMUSE00000649526 Chr15:41682921..41683073 CCATGGATAGCCAATGGTTC Chr15:41682965..41682984 60.15 50
downstream ENSMUSE00000649482 Chr15:41684868..41684963 TGGCTCTGATGCTAATGCAC Chr15:41684897..41684916 59.98 50
downstream ENSMUSE00000649525 Chr15:41684868..41684963 TGGCTCTGATGCTAATGCAC Chr15:41684897..41684916 59.98 50
downstream ENSMUSE00000649480 Chr15:41686467..41686540 CTCCACCACCAAATGCTAATG Chr15:41686541..41686561 60.37 47.62
downstream ENSMUSE00000649523 Chr15:41686467..41686540 CTCCACCACCAAATGCTAATG Chr15:41686541..41686561 60.37 47.62
downstream ENSMUSE00000649479 Chr15:41690704..41692591 CTGTGTGCGCTGTGGTCTAT Chr15:41691472..41691491 59.93 55
downstream ENSMUSE00000649500 Chr15:41690704..41692594 CTGTGTGCGCTGTGGTCTAT Chr15:41691472..41691491 59.93 55
downstream ENSMUSE00000649522 Chr15:41690704..41692591 CTGTGTGCGCTGTGGTCTAT Chr15:41691472..41691491 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGCTTATAATCGCCTTGC Chr15:41279179..41279199 59.84 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCTTACGTGACTGGGAAAA Chr15:41279181..41279201 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022307