Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2287
Trapped Gene
Mrpl20 (ENSMUSG00000029066)
Vector Insertion
Chr 4: 155181095 - 155182587
Public Clones AG0449 (sanger) CMHD-GT_399E9-3 (cmhd)
Private Clones OST413035 (lexicon) OST128210 (lexicon) OST87676 (lexicon) OST71313 (lexicon)
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000185187 (Chr4:155181017..155181094 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATGGCTTAAAGTACCCAGCA Chr4:155181053..155181073 60.14 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000185187 (Chr4:155181017..155181094 +)
Downstram Exon
ENSMUSE00000228704 (Chr4:155182588..155182938 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATGGCTTAAAGTACCCAGCA Chr4:155181053..155181073 60.14 47.62 TGGTACTGCACCACTCTGGA Chr4:155182760..155182779 60.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000185188 Chr4:155177743..155177851 CATCATGGTCTTCCTCACGA Chr4:155177761..155177780 59.63 50
upstream ENSMUSE00000185186 Chr4:155177942..155178052 TAAGAAGCGGAACCTGAGGA Chr4:155178031..155178050 59.95 50
upstream ENSMUSE00000185187 Chr4:155181017..155181094 CATGGCTTAAAGTACCCAGCA Chr4:155181053..155181073 60.14 47.62

*** Putative Vector Insertion (Chr 4: 155181095 - 155182587) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000228704 Chr4:155182588..155182938 TGGTACTGCACCACTCTGGA Chr4:155182760..155182779 60.31 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCCTTATCAAGGTGCTGAG Chr4:155181105..155181125 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCCTTATCAAGGTGCTGAG Chr4:155181105..155181125 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029066