Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22871
Trapped Gene
6430514L14Rik (ENSMUSG00000032224)
Vector Insertion
Chr 9: 69938699 - 69941297
Public Clones not available
Private Clones OST282520 (lexicon)
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000635739 (Chr9:69941298..69941490 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGAGATGAAAGCGGAGGTT Chr9:69941305..69941324 60.21 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000635739 (Chr9:69941298..69941490 -)
Downstram Exon
ENSMUSE00000635737 (Chr9:69937117..69938698 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGAGATGAAAGCGGAGGTT Chr9:69941305..69941324 60.21 50 GCTTAGCCACCATCCCATTA Chr9:69937767..69937786 59.92 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696363 Chr9:69989120..69989364 No primer for this exon
upstream ENSMUSE00000696362 Chr9:69973994..69974090 CCCAACAGGACACCGTACTT Chr9:69974046..69974065 59.88 55
upstream ENSMUSE00000532202 Chr9:69972731..69973004 ACATCGTCAGCAGTTTGCAG Chr9:69972836..69972855 60.06 50
upstream ENSMUSE00000384243 Chr9:69958065..69958183 CTGCCTTAAAGACGCTGGAG Chr9:69958112..69958131 60.15 55
upstream ENSMUSE00000635746 Chr9:69950627..69950756 GCTCTCTGCCGAGCATAAGT Chr9:69950716..69950735 59.75 55
upstream ENSMUSE00000635742 Chr9:69946895..69947001 CAGAGCAGAGCACCAAACTG Chr9:69946945..69946964 59.77 55
upstream ENSMUSE00000635741 Chr9:69943858..69943993 TAAAGGCACCGTTGAAGAGC Chr9:69943971..69943990 60.39 50
upstream ENSMUSE00000635739 Chr9:69941298..69941490 AGGAGATGAAAGCGGAGGTT Chr9:69941305..69941324 60.21 50

*** Putative Vector Insertion (Chr 9: 69938699 - 69941297) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000635737 Chr9:69937117..69938698 GCTTAGCCACCATCCCATTA Chr9:69937767..69937786 59.92 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAGATGAAAGCGGAGGTT Chr9:69941303..69941323 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGAGATGAAAGCGGAGGTT Chr9:69941303..69941323 60.21 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032224