Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2288
Trapped Gene
C330013J21Rik (ENSMUSG00000074529)
Vector Insertion
Chr 2: 177656521 - 177660263
Public Clones AG0443 (sanger) CA0249 (sanger) CA0248 (sanger) RRK367 (baygenomics)
IST11349G12 (tigm) IST11026H4 (tigm) IST10927F2 (tigm) IST11026H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678552 (Chr2:177660264..177660355 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGTGCTGCGAGGGTAACTC Chr2:177660289..177660308 60.02 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678552 (Chr2:177660264..177660355 -)
Downstram Exon
ENSMUSE00000547059 (Chr2:177656394..177656520 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGTGCTGCGAGGGTAACTC Chr2:177660289..177660308 60.02 60 AAAGCCCCCTCTTCCTGAGT Chr2:177656443..177656462 61.48 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678552 Chr2:177660264..177660355 GAGTGCTGCGAGGGTAACTC Chr2:177660289..177660308 60.02 60

*** Putative Vector Insertion (Chr 2: 177656521 - 177660263) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000547059 Chr2:177656394..177656520 AAAGCCCCCTCTTCCTGAGT Chr2:177656443..177656462 61.48 55
downstream ENSMUSE00000638706 Chr2:177656140..177656200 No primer for this exon
downstream ENSMUSE00000678550 Chr2:177654632..177654860 GCAAAGGCTTTACCACATTGA Chr2:177654776..177654796 60.12 42.86
downstream ENSMUSE00000678551 Chr2:177637767..177638432 GGGGGTCTTTCATTAGCACA Chr2:177638350..177638369 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGTATGGGGCCTCTCTGT Chr2:177657249..177657269 60.48 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGTATGGGGCCTCTCTGT Chr2:177657249..177657269 60.48 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr2:177657286..177657306 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GGCTCTTCCGGGTACTAAGC Chr2:177657377..177657397 60.23 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074529