Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI22881
Trapped Gene
Fbxo44 (ENSMUSG00000029001)
Vector Insertion
Chr 4: 147532933 - 147533851
Public Clones not available
Private Clones OST282148 (lexicon) OST40039 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000399077 (Chr4:147533852..147533989 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGAAGGAGGGGAGCAGTG Chr4:147533969..147533988 61.77 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000399077 (Chr4:147533852..147533989 -)
Downstram Exon
ENSMUSE00000371999 (Chr4:147532646..147532932 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGAAGGAGGGGAGCAGTG Chr4:147533969..147533988 61.77 60 CAGCTCGTTGATGTTGCCTA Chr4:147532862..147532881 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000399077 Chr4:147533852..147533989 ACAGAAGGAGGGGAGCAGTG Chr4:147533969..147533988 61.77 60

*** Putative Vector Insertion (Chr 4: 147532933 - 147533851) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000371999 Chr4:147532646..147532932 CAGCTCGTTGATGTTGCCTA Chr4:147532862..147532881 60.01 50
downstream ENSMUSE00000667224 Chr4:147530718..147530815 GGTCATTGGGGAATTCCTTT Chr4:147530698..147530717 60 45
downstream ENSMUSE00000342201 Chr4:147530689..147530815 GGTCATTGGGGAATTCCTTT Chr4:147530698..147530717 60 45
downstream ENSMUSE00000385299 Chr4:147530504..147530599 CCAATACCCTTCAGCCTTGA Chr4:147530529..147530548 60.07 50
downstream ENSMUSE00000336662 Chr4:147530255..147530390 GCTGACGACAGGAGTTGGAC Chr4:147530306..147530325 60.87 60
downstream ENSMUSE00000667223 Chr4:147530255..147530390 GCTGACGACAGGAGTTGGAC Chr4:147530306..147530325 60.87 60
downstream ENSMUSE00000667221 Chr4:147528531..147528542 No primer for this exon
downstream ENSMUSE00000393062 Chr4:147526910..147527753 AAACCCTGGTCCATCCTACC Chr4:147527033..147527052 60.05 55
downstream ENSMUSE00000667222 Chr4:147526910..147527753 AAACCCTGGTCCATCCTACC Chr4:147527033..147527052 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTGAGGCACAGTGGGCTA Chr4:147533798..147533818 61.42 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000029001